... THEORETICAL PRINCIPLES AND METHODS OF REMEDIATION OF SOILS POLLUTED WITH HEAVY METALS . Galina Koptsik . ... Development of current principles and approaches for soil remediation in heavy metal polluted areas. ... The project aims to study and develop, both theoretically and experimentally, the current approaches to remediation of soils polluted with heavy metals. ... Potentialities and constraints of different approaches for remediation of heavy metal polluted soils will be analysed. ...

Еще в разделе: (Показать все результаты (>22) - eco.soil.msu.ru/ )

• THEORETICAL BASES AND EXPERIMENTAL ANALYSIS OF SOIL SOLUTION TRANSFORMATION

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ­ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ­ 0, (op on sequence) (guard) ­ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect02.pdf

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... Cancellation policy for all excursions: The cancellation of the tours before May 22, 2013 - no penalty. ... Time : will be announced soon . The price includes : transfer Moscow-Suzdal-Moscow, 1 night accommodation, meals according to the program, entrance tickets, English speaking guide. Suzdal is a calm old Russian town situated 220 km north-east of Moscow, 38 kilometers north from the city Vladimir, on the Kamenka river. ... Tour program: . ... Excursion to State Tretyakov Gallery . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Symposia

... Phys. 48 (2000) 5 ± 7, 637 ± 641 ± ± Generation of Entanglement in a System of Two Dipole-Interacting Atoms by Means of Laser Pulses I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Abstract Effectiveness of using laser field to produce entanglement between two dipole-interacting identical twolevel atoms is considered in detail. ... 6] R. G. Brewer, Phys. Rev. A 52 (1995) 2965. ...

Еще в разделе: (Показать все результаты (>96) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA-2000-61-52305-en.pdf
• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/UFN-2001-44(6)-en.pdf

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Description
• SAI OCL Catalog Publications
• SAI Open Star Clusters (SAI OCL) Catalog

GCVS Research Group: . Recent publications . Kazarovets E.V., Samus N.N., Durlevich O.V., Kireeva N.N., Pastukhova E.N., The 81st Name-List of Variable Stars. ... Kazarovets E.V., Samus N.N., Durlevich O.V., Kireeva N.N., Pastukhova E.N., The 80th Name-List of Variable Stars. ... Samus N.N., Kazarovets E.V., Kireeva N.N., Pastukhova E.N., Durlevich O.V. General Catalogue of Variable Stars: Current status and new Name-lists Odessa Astronomical Publications, 2010, V. 23, p. 102-105. ...

Еще в разделе: (Показать все результаты (>157) - sai.msu.ru/ )

• International School "Frontiers in Numerical Gravitational Astrophysics"
• А С Т Р О К У Р Ь Е Р

... Smurova KM, Alieva IB, Vorob'ev IA. Free and centrosome-attached microtubules: quantitative analysis and themodeling of two-component system. ... Genes Cells. ... Mimori-Kiyosue Y, Grigoriev I, Lansbergen G, Sasaki H, Matsui C, Severin F, Galjart N, Grosveld F, Vorobjev I, Tsukita S, Akhmanova A. CLASP1 and CLASP2 bind to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J Cell Biol. ... Cell Biol Int. 2004;28(2):139-50. ... Membr Cell Biol. 1997;11(2):195-211. in Russian . ...

Еще в разделе: (Показать все результаты (>40) - cellmotility.genebee.msu.ru/ )

• publications2

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>45) - cdfe.sinp.msu.ru/ )

• EXFOR Search Engine
• CDFE => Online Services => Relational ENSDF
• CDFE => Online Services => Nucleus Ground State Parameters

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>134) - hbar.phys.msu.ru/ )

• Ответ Wally на книгу "Крах С14"

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

... Russian: ps 2 pages . Published in: Russian Math. Surveys 57 (2002), no.3. ... English: ps (gzipped) 41 pages . ... Finitely presented groups and semigroups in knot theory. Russian: ps (gzipped) tex . English: ps (gzipped) tex . ... Russian: ps (gzipped) English: ps 20 pages . arXiv.org e-Print archive: http://arXiv.org/abs/math.RA/0205042 . ... Russian: ps English: ps 11 pages . ... In this paper we introduce and study gauge-equivariant $K$-theory groups $K_\GR^i(Y)$. ...

Еще в разделе: (Показать все результаты (>142) - higeom.math.msu.su/ )

• Alexey Garber
• S.P.Novikov Seminar
• Publications (Russian)

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on «English for Students of Mathematics and Mechanics» by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>23) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Podkolzina_TA_Test_Your_Knowledge_of_Great_Britain.pdf
• http://www.eng.math.msu.su/download/theses2.pdf
• http://www.eng.math.msu.su/download/Reports.pdf

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>165) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kholodov-retention.pdf
• MGUMUS -- Vladimir A. Kholodov
• MGUMUS -- Researches

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>5) - www.cmc-online.ru/ )

THE JOURNAL OF CHEMICAL PHYSICS 133, 144101 2010 Effective numbers of modes applied to analysis of internal dynamics of weakly bound clusters A. A. Rybakov,a E. D. Belega, and D. N. Trubnikov Department of ... Russia Received 11 June 2009; accepted 14 September 2010; published online 11 October 2010 The dependence of the volume of the chaotic component in the internal dynamics of triatomic van der Waals clusters on the angular ... When such difference is small, the regular motion disappears. ...

Еще в разделе: (Показать все результаты (>18) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/sotrudniki/larin/CC_EF1f.doc
• http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>10) - lcc.chem.msu.ru/ )

• Publications

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>11) - hit-conf.imec.msu.ru/ )

... Search for Single Top Quark Production at DZero using Neural Networks" . ... Search for Single Top Quark Production at D0 Using Neural Networks" . ... Search for Electroweak Production of Single Top Quarks" . ... Use of Neural Networks in a Search for Single Top Quark Production at D0", . ... Search for Single Top Quark Production at the Tevatron" . ... Use of Neural Networks in a Search for Single Top Quark Production with the DZero Detector at the Fermilab Tevatron Collider", . ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )

• Lev V. Dudko Home Page