МГУ имени М.В.Ломоносова Русская версия . ... Asian and African Studies . Computational Mathematics and Cybernetics . ... Art Criticism and History . History and Art History . Section Mathematics and mechanics . ... Public Relations and Theory of Communication . ... Theory, History and Methodology of Translation . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... Theory and methods of teaching mathematics . ... МГУ имени М.В. Ломоносова . ...
... АЛГОРИТМЫ, предназначенные для обработки изображений целесообразно писать на С++, с широким использованием шаблонов и методов метапрограммирования. ... Пикселей много, и понятно, что здесь необходимо задумываться об эффективности кода, даже не потому, чтобы добиться максимального быстродействия, а потому, что просто иначе программу нельзя будет нормально отлаживать (пусть например время обработки изображения больше часа, сколько потребуется потратить времени, чтобы найти ошибку?) ...
News of PARALLEL.RU par-news на mail.parallel.ru . ... Разработка грид-сервиса управления заданиями ГридННС Pilot на основе архитектурного стиля REST . http ://agora.guru.ru/parallel ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + Intel представляет секцию параллельное программирование конференции TechDays.ru. http ://www.techdays.ru/category/21.html + Georgia Institute of Technology создает Institute for Data and High Performance Computing ...
... профессор А.В. БАЕВ . профессор А.В. РАЗГУЛИН . ... РАЗГУЛИН . ... функционально-дифференциальные уравнения с преобразованием пространственных аргументов . ... Разгулин А.В. Аппроксимация задачи управления преобразованием аргументов в нелинейном параболическом уравнении // Ж. вычисл. матем. и матем. физ., ... Разгулин А.В. Задача управления двумерным преобразованием пространственных аргументов в параболическом функционально-дифференциальном уравнении // Дифференц. уравнения. 2006, т. 42, ? ...
... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Конференции: Календарь / Материалы . ... Геология >> Геотектоника | Анонсы конференций . ... 15.09.2003 | ... А.Б. Кирмасов . 8-я Европейская конференция по численному моделированию мантийной конвекции и геодинамике литосферы 1318 сентября 2003, Чехия, Castle of Hruba Skala Организаторы: Пражский Университет Контакты: O. Cadek Department of Geophysics, Charles University, V Holesovickach 2 Prague 18000 CZECH . ...
Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...
... The characteristics of the materials we have selected, the procedure of winding the optic fibers and the coating process are described in detail. ... The `passive' inner cylinder, shown in the left part of the picture, was machined from an anticorodal aluminum rod while the conical part is used to lead the optic fibers from the coils down to the axis of the hydrophone. ... 6: The sensor after the coating process: the hydrophone (right) and the box --7-- containing the two fiber Bragg gratings. ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
Serge Moscovici . Social Representations mailing list 1 postings, 28 Apr - 27 May 1997 . ... Deriabin wonders why social constructionism and social representations do not get close to one another. ... I cannot see where and how the theory of social representations has been rewritten to fit the cognitive paradigm. ... What is important for me now, at this point of my thinking, is the following: without a theory of social representations, we cannot understand social construction. ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
... A.N. Osiptsov, S.L. Veselyi, V.A. Kulikovskii, B.Y. Wang, The flow structure of dilute gasparticle suspensions behind a shock wave moving along a flat surface // Appl. ... A.N. Osiptsov, E.G. Shapiro, Heat transfer in the boundary layer of a "gas-evaporating drops" two-phase mixture // Int. J. Heat Mass Transfer. ... 1998. ... Multiphase Flow. ... Heat transfer to a stagnation region of a blunt body in a hypersonic flow with an admixture of solid particles// In: Proc. 3d Europ. ... 2008. ... 2007. ...
[
Текст
]
Ссылки http://lab110.imec.msu.ru/Documents/General/Lab_results.pdf -- 255.7 Кб -- 23.01.2013 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Общие курсы . Введение в языкознание . Общее языкознание . ... Сравнительно-историческое индоевропейское языкознание . ... Учебная деятельность : Специализации : Сравнительно-историческое индоевропейское языкознание . Введение в общую и индоевропейскую просодику . ... Герценберг 1982 - Герценберг, Л. Г. О следах индоевропейской просодики в латинском // Вопросы языкознания 5 (1982). ... Общее собрание студентов по специализации "Сравнительно-историческое индоевропейское языкознание" . ...
In the three and a half years of itтАЩs existence, the participants of the Ecological Cooperation Project have carried out more than 200 activities towards conserving and protecting the environment. ... Activities: . ... During the "We'll Conserve the EarthтАЩs Beauty" project at the Silicate lakes, near Lipetsk, the waste around a lake and in a forested area nearby was cleaned up. ... The members of ecological club from Gymnasium #1529, in Moscow, had a summer expedition to Solovetsky museum in 1999. ...
... On-line консультант . ... В оформлении списка цитируемой литературы используются следующие поля: . ... Поле 6. Разделитель после поля пробел . ... Разделитель после поля : (двоеточие) пробел . ... Разделитель после поля , (запятая) пробел . ... Разделитель после поля пробел с (p латинское) (строчная буква) . ... Разделитель после поля пробел // (два слэша) пробел . ... Разделитель после поля [. (точка) пробел] ? ... Разделитель после поля пробел с. (строчная буква и точка) пробел Деп. в пробел . ...
... РАДИКАЛЫ СВОБОДНЫЕ , хим. частицы с неспаренными электронами на внеш. орбиталях ; обладают парамагнетизмом и высокой реакц. способностью. ... К p-элект-ронным относятся алкильные, аллильный и бензильный радикалы, а также ион-радикалы ароматич. углеводородов , циклооктатетраена , дивинила и подобных частиц, например: . ... Короткоживущие Р. с. К таким радикалам относятся атомы и сложные хим. частицы с локализованными неспаренными электронами (своб. валентностями), например . ... Радикалы, пер. с англ...
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
... УНИВЕРСИТЕТ имени М.В.ЛОМОНОСОВА . ... Ленинские горы, МГУ им. М.В. Ломоносова, . ... новости о совете деятельность ссылки гранты и конкурсы конференции и семинары . ... кандидат биологических наук, старший научный сотрудник НИИ ФХБ . ... кандидат физико-математических наук, доцент механико-математического факультета . ... кандидат химических наук, доцент факультета наук о материалах . ... кандидат исторических наук, доцент исторического факультета . ... Совет молодых ученых МГУ имени М.В.Ломоносова...
... Библиотека / The Somoninge of Everyman . ... GOD . ... EVERYMAN . ... FELAWSHIP . ... GOODES . ... GOOD DEDES . ... In my glory sholde make his mansion, . ... Where arte thou, Deth, thou mighty messengere? ... Hast thou thy Maker forgete? ... Thy many badde dedes, and good but a fewe, . ... And yet, if thou wilte ete, and drinke, and make good chere, . ... Good Dedes, I praye you helpe me in this nede, . ... Helpe my Good Dedes for my piteous exclamacion! . ... The Good Dedes shall make all sure. ...