Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...
... Количественные методы оценки темпов звездообразования по наблюдениям в различных диапазонах спектра . ... Распределение областей звездообразования по диску галактик . ... в) звездообразование в ядерных дисках . ... On the size and formation mechanism of star complexes in Sm Im and BCD galaxies" //ApJ467,579 . ... Cepa & de Pablos "Star formation rates, efficiencies and initial mass functions in spiral galaxies" // 1997 Star formation near and far conference series: sfnf.conf.433D . ...
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
... TELLING AMERICA'S STORY: NARRATIVE FORM AND THE REAGAN PRESIDENCY WILLIA M E LEWI S By 1980 , Americ a ha d los t its sense of direction . ... The n Ronal d Reaga n cam e ont o th e scene wit h a visio n of America that reinvigorate d th e nation . ... NARRATIV E FOR M I N REAGAN' S RHETORI C Reaga n tells tw o kind s of stories tha t differ in scale an d purpose , but that wor k togethe r to establish th e dominanc e of narrativ e form in th e creation and in th e interpretatio n of his rhetoric . ...
... Публикации 2015 года . ... 2563496, 25 августа 2015 г. Тезисы докладов: . ... Москва: ЦИАМ им. П. И. Баранова, 2015. ... Волны в вязкоупругом слое, расположенном под слоем движущейся жидкости // Тезисы докладов VIII международной конференции 'Лаврентьевские чтения по математике, механике и физике'. ... Публикации 2014 года . ... Секция механики. 14 - 23 апреля 2014, Москва, МГУ имени М. В. Ломоносова. ... Публикации 2013 года . ... Секция механики. 15-23 апреля 2013, Москва, МГУ имени М.В.Ломоносова...
... 2013г. Вохник О.М., Зотов А.М., Короленко П.В., Рыжикова Ю.В. Моделирование и обработка стохастических сигналов и структур. ... Короленко П.В., Рыжикова Ю.В. Фрактальные представления в анализе явлений дифракции и интерференции // Сборник тезисов докладов научной конференции 'Ломоносовские чтения'. ... Грушина Н.В., Зотов А.М., Короленко П.В., Мишин А.Ю. Оптические свойства одномерных апериодических систем // Сборник тезисов докладов научной конференции 'Ломоносовские чтения 2009' Секция физики. ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... Current results . Scientific results . ... Human biomaterial . In recent years the emergence of new man-made environmental factors led to adverse (resulting in negative economic and social consequences) changes in the human population structure. This results in significant changes in the population structure, namely the reduction and disappearance of certain groups of the population (carriers of certain genetic, phenotypic, economic and cultural characteristics). ...
Dear friends, It is less than three weeks left till the 39th IChO starts. ... Currency and cards. Russian rouble is the only currency accepted throughout Russia. ... To attention of Head mentors intending to pay fees on arrival in cash: payments will be accepted in Russian roubles only. ... During the IChO, mentors and guests will stay in Holiday Inn Sokolniki, and students in the Olympian camp, which is also an option for early arrivals and late departures. ... The 39th IChO Organizing Committee ...
[
Текст
]
Ссылки http://www.icho39.chem.msu.ru/html/english/Participation/Pre-arrival%20circular.pdf -- 9.7 Кб -- 29.06.2007
[
Текст
]
Ссылки http://icho39.chem.msu.ru/html/english/Participation/Pre-arrival%20circular.pdf -- 9.7 Кб -- 29.06.2007 Похожие документы
Quantum Chemistry in Studies of Elementary Stages of Enzymatic Catalysis Alexander Nemukhin Department of Chemistry M.V. Lomonosov Moscow State University Russian Federation N.M. Emanuel Institute of Biochemical Physics Russian Academy of Sciences The aim is to study mechanisms of chemical reactions in complex molecular environment by considering J. Phys. Chem. ... Chem., ... Modeling, 2005, 11, 503 Grigorenko B., Rogov A., Nemukhin A. // J. Phys. Chem. ...
Молекулярная динамика . Расчетные методы симуляции молекулярной динамики базируются на представлениях классической механики, движение атомов описывается в формализме уравнений Ньютона для системы N взаимодействующих частиц: . Каждый атом считается находящимся в силовом поле, создаваемом другими атомами, сила взаимодействия будет выражаться как производная функции потенциальной энергии. ... Использование уравнений Ньютона автоматически приводит нас к классическому описанию движения атомов. ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...