Еще в разделе: (Показать все результаты (>3) - www.botsad.msu.ru/ )

• Index nominum 216 Index nominum 216
• Index nominum 218

... Первая десятка | ... Первая десятка "Русского переплета" Темы дня: . ... Часть первая ДРЕВНИЙ МИР I. ВОСТОК 1. ... АРИЙЦЫ В АЗИИ а) Индийцы . ... АРИЙЦЫ ДРЕВНЕГО МИРА а) Греки . ... в) Разложение древнего мира и начало нового Часть вторая НОВЫЙ МИР 1. ... Работы различных лет 1868-1876 гг. ... Copyright (c) "Русский переплет" . ...

Еще в разделе: (Показать все результаты (>175) - www.pereplet.ru/ )

• About this document ...
• Super Ratio

... ICONO Symposium on Femtosecond Laser Pulse Filamentation . Co-Chairs: Sea Leang Chin (Laval Univ., ... Russia) . ... In the past 15 years, he turned his attention to study the physics and applications of femtosecond laser filamentation in all optical materials, in particular, in air and is one of the leading scientists in this field. ... INVITED : в?? ... Efficient THz generation by optical rectification of femtosecond laser pulses and application of THz radiation for plasma investigation в??, ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Program topics

... Variables representing the environmental conditions were `food' and `infection'. ... APPENDIX 1 An example of optimal life -history traits values (for a = 1.7 and m = 0.9) t 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ... 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 z Et 2.3 2.5 2.7 2.8 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.8 3.9 4.0 4.0 4.1 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 ...

Еще в разделе: (Показать все результаты (>35) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Beta_ActaOec.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1999_Seasons_EER.pdf

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on «English for Students of Mathematics and Mechanics» by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>28) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part1.pdf
• http://www.eng.math.msu.su/download/Academic_English_4.pdf
• http://www.eng.math.msu.su/download/plan.pdf

... An implementation of this method known as the generalized marching algorithm is described in detail in [1] . ... Molar mass . ... Массовый момент . ... This subroutine performs row and column scalings to equilibrate (to balance) a real general matrix . Масштабирование матриц . ... Mass matrix . ... This set has fewer elements than $K$ has . ... Метод . The method for solving the problems in mechanics . ... Метод моментов . ... Модули диаграммы секущий и касательный . ... Concrete modulus . ...

Еще в разделе: (Показать все результаты (>801) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/eng_math/redict/23.htm
• БЧА НИВЦ МГУ. ALN1R_C. Специальные задачи линейной алгебры
• Причастные обороты

... The study of adaptive variability, i.e. the study on the population level of the physiological adaptation of the human organism to a variety of environmental conditions, is the main purpose and the basic principle of physiological anthropology. ... Regional rates of hormonal activity of indigenous population of different ethno-territorial groups that we have elaborated broaden our notions about common conformities of age variability and aging and the reasons of these processes. ...

Еще в разделе: (Показать все результаты (>28) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_4.doc
• http://www.antropos.msu.ru/vestnic/e2013_4.doc
• http://www.antropos.msu.ru/vestnic/pravila_eng.doc

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>18) - www.issp.ac.ru/ )

• Chair of MIPT in ISSP RAS, Chernogolovka
• Filial of Chair of MISiS in ISSP, Chernogolvka
• II International Astronomy Olympiad, Problems to solve

... Начало www.99ru.ru Религия и эзотерика Христианство 1314 . ... История.Философия . ... Застольные беседы (речи) Мартина Лютера 1566г репринт оригинала Luthers Tischreden Немецкий Готический шрифт . ... Martin Luther died on the 18th of February, 1546, and the first publication of his "Table Talk"-Tischreden-by his friend, Johann Goldschmid (Aurifaber), was in 1566, in a substantial folio. ... He began his studies at the University of Wittenberg in 1537, where he attached himself closely to Luther. ...

Еще в разделе: (Показать все результаты (>51) - www.bukivedi.ru/ )

• www.99ru.ru -

... Electronic journal Issue 4. 10 september 2004 Ulrich M. Sustainable Management of Natural Resources Introduction. ... To learn about the dynamics of natural resource management and the tragedy of the commons by means of a direct experience in the simulation game «NEW COMMONS GAME». ... 2) Tragedy of the commons and management of natural resources. ... The simulation game was followed by a short debriefing on the dynamics of the tragedy of the commons and natural resource management. ...

Еще в разделе: (Показать все результаты (>15) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы для школьников . Заочная Астрономическая Школа . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ... Курсы факультетов МГУ . ...

Еще в разделе: (Показать все результаты (>3) - distant.msu.ru/ )

details, including instructions for authors and subscription information: http://www.informaworld.com/smpp/title~content=t713453505 Observations of gamma-ray bursts and a supernovae search at the robotic telescope MASTER V. M. Lipunov ab; V. G. Kornilov ab; A. V. Krylov a; D. A. Kuvshinov b; E. S. Gorbovskoy b; N. V. Tyurina a; A. A. Belinsky a; G. V. Borisov a ... Stellar magnitude >17.8 18.6 ± 0.3 19.4 ± 0.3 Exposure time (s) 45 15 в 30 15 в 30 Comments Upper limit 82 V. M. Lipunov et al. ...

Еще в разделе: (Показать все результаты (>42) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/lipunov_et_al/M81
• http://observ.pereplet.ru/cbet3962.html
• http://observ.pereplet.ru/images/evgeny/article/2007/statia_AZh_eng3.pdf

Государственное учебно-научное учреждение Московского государственного университета имени М.В.Ломоносова . ... Информация . ... История медицинского образования в МГУ . ... Аспирантура . ... Учебные планы . ... Введение в доказательную медицину (3 часа) . ... Источники информации в доказательной медицине(3 часа) . ... Клинические исследования как основа доказательной медицины (3 часа) . ... Факультет фундаментальной медицины Московского государственного университета им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>32) - fbm.msu.ru/ )

... Also, if events can be split up into distinct but overlapping events, how do you approximate the fluences of the individual events? ... In any cases, You can observe new increasing the E>30 MeV fluxes after first event. ... And for that case, what should be difference in fluences, predicted by different models. ... Fig. ... For different SEP model characteristics were used different events sets. 183 were physical events, what were used for development of the regularities, inherent to the SEP events....

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/hilgers.pdf
• http://srd.sinp.msu.ru/nymmik/models/ISOTS04.pdf
• Rikho Nymmik

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>18) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ
• TLE news

... Chilingarian, I., Melchior, A.-L., Zolotukhin, I. 2010: Analytical approximations of K -corrections in optical and near-infrared bands , MNRAS, v. 405, p. 1409 (also arXiv:1002.2360) . ... Calculator . ... calculate spectral energy distributions , K-corrections calculator , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>8) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

О лаборатории . ... Лаборатория теоретической биофизики . ... Some distributives (gentoo, openSuse, etc.) contains default Pymol љwithout vmd molfile plugins. ... Download pymol sources from sourceforge: pymol-1.4.1 . ... Open file setup.py and uncomment everything related to VMD molfile. ... Нет комментариев " Pymol compilation with VMD Molfile plugins " . ... Building and plotting Fukui function with FireFly and PyMol . Visualize partial charges in PyMol . ... 2013 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>30) - erg.biophys.msu.ru/ )

• Visualize partial charges in PyMol ERG Research Group: Лаборатория
• Using spherical functions (from A.Granovsky manual) ERG Research Group:
• Quantum chemistry information page ERG Research Group: Лаборатория

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Selenga-Baikal research

... 21-Jan-2011 12:20 . 1.2M . ... 03-Feb-2011 16:54 . ...

Еще в разделе: (Показать все результаты (>150) - www.chem.msu.ru/ )

• Семинар "Перспективные наноматериалы"
• Program esrD
• Dmitriy Mendeleev Online