... Рифабутин, спиропиперидиловое производное рифампицина, не отличаясь от последнего по спектру действия, обладает рядом преимуществ, к числу которых относятся: . ... РБ превосходит РМ по основным фармакокинетическим показателям: он хорошо проникает в ткани и жидкости организма, характеризуется большим объемом распределения, более высоким соотношением концентраций ткани/кровь, более длинным периодом полувыведения (пролонгированное действие). ... АНТИБИОТИКИ И ХИМИОТЕРАПИЯ, 1999-N8, стр. ...
... In their previous pap ers, the authors of this study have suggested and realized a method of simultaneous determination of temp erature and salinity of seawater using laser Raman sp ectroscopy, with the help of neural networks. ... This pap er presents comparison of various input data compression methods using feature selection and feature extraction and their effect on the error of determination of temp erature and salinity. ... Walrafen, G.E.: Raman Sp ectral Studies of Water Structure. ...
[
Текст
]
Ссылки http://rswater.phys.msu.ru/Assets/Water/ICANN_manuscript.pdf -- 235.4 Кб -- 15.10.2012 Похожие документы
... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...
Challenges of Data Processing for Earth Observation in Distributed Environments Dana Petcu Abstract. ... Earth observation (EO) is most often referring to satellite imagery or satellite remote sensing, the result of sensing process being an image or a map. ... Data Processing. ... The parallel remote-sensing image processing software PRIPS was encapsulated into a Grid Challenges of Data Processing for Earth Observation in Distributed Environments 13 service in [20]. ... Remote Sensing Grid. ...
[
Текст
]
Ссылки http://angel.cs.msu.su/~oxana/image_processing/papers/2009-02370009.pdf -- 714.4 Кб -- 30.07.2009 Похожие документы
... Eagle Broadband Picks Terremark NAP . Eagle Broadband Picks Terremark NAPEagle says it selected Terremark NAP of the Americas because of its secure and reliable connection to customers throughout the US. The NAP of the Americas will serve as the central distribution hub for Eagle IPTV solution. this industry trend continues to get traction, we are delighted to welcome Eagle Broadband as one of the first IPTV distributors to our facility, says Manuel Medina, chairman and CEO of Terremark. ...
MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...
DESCRIPTION OF THE TIME PROFILES OF KEY GEOMAGNETIC AND SOLAR WIND PARAMETERS . Time profiles of key geomagnetic parameters ( Ap and Dst indices) are shown together with key parameters of the solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM coordinate system). ... High time resolution data on the solar wind plasma is obtained from Wind experiment in 1997 and ACE experiment in 1998-2002 using ISTP data base . ...
Program XXXVI International Conference of the Russian Society for American Culture Studies Nature and Sustainability of Culture Moscow, December 3-10, 2010 Section 1. ... Nature in the nineteen-century American culture (The concept of Nature and its evolution from Romanticism to Naturalism. ... O.Y. Danchevskaya Moscow State Pedagogical University, Moscow, Russia Concept of Soul among North American Indians Soul is probably the most vital notion in any religion, though ideas about it vary greatly. ...
[
Текст
]
Ссылки http://www.journ.msu.ru/eng/conferences/2010/program2010engl.doc -- 155.5 Кб -- 26.11.2010 Похожие документы
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
... Главная Факультет политологии Новости факультета Новость . ... 17 ноября на факультете политологии МГУ имени М. В. Ломоносова состоялась лекция директора программы?Россия и Евразия? Центра стратегических и международных исследований Эндрю Качинса ?Putin the Politician: The Evolution of his Domestic Political Strategy for Success from 2000 to 2015?. ... Расписание экзаменов . Факультет . ... Поступление на факультет политологии в 2016 году . ... Информация о переводе на факультет политологии . ...
Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...
... О кафедре . ... КРИВОНОЖКО Владимир Егорович (11.06.1948, г. Москва) д.физ.-мат.н., профессор МФТИ, зав. кафедры АСУ МИСИС. ... Krivonozhko V. E., F rsund F. R. Lychev A. V. Terminal units in DEA: Definition and Determination // University of Oslo. ... F rsund F. R., Krivonozhko V. E., Lychev A. V. Hidden Effects in DEA Models //Differential Equations. ... Krivonozhko V. E., F rsund F. R., Lychev A. V. Some Ulterior Effects in the DEA models // Abstracts of the INFORMS Annual Meeting. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Alexeyev V.L., Levich A.P. A search for maximum species abundances in ecological communities under conditional diversity optimization // Bull. of Mathemat. ... 1997. ... Bendoricchio G., JЬrgensen S.E. Exergy as a goal function of ecosystems dynamic // Ecological modelling. ... 1999. ... Comolli C.J., Donohue C., Timothy J. Pseudomonas aeruginosa RoxR, a response regulator related to Rhodobacter sphaeroides PrrA, activates expression of the cyanide- insensitive terminal oxidase. ... 1995. ... 2000. ...
[
Текст
]
Ссылки http://dis.bio.msu.ru/States/Fursova_Mil'ko_levich/Spisok.pdf -- 167.3 Кб -- 03.12.2009 Похожие документы
... 2.2 A d-graph . ... of external monads . ... The addition of one x-structure is called an elementary extension. ... If this elementary extension generates several loops with the set {Xa } of start (finish) x-structures, then the set of monads of one kind (the creation or the annihilation) that belong to {Xa } is a antichain. ... If the next external elementary extension appears close ~ by the first we have two new growing sequences of L. This structure describes the collision of two minimons. ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/krugly_discrete-sequential.pdf -- 1186.5 Кб -- 28.02.2014 Похожие документы
Experimentation and Personality , 1 Explicating the Black Box through Experimentation : Studies of Individual Differences and Cognitive Processes Howard Lavine Department of Political Science, SUNY Stony Brook Stony Brook, NY 11794-4392 Howard.Lavine@sunysb.edu Corresponding Author Milton Lodge Department of Political Science, SUNY Stony Brook Stony Brook, NY 11794-4392 Milton.Lodge@sunysb.edu James Polichak School of Law, University of Michigan ... The Authoritarian Personality. ...
[
Текст
]
Ссылки http://www.suny.msu.ru/ru/Lavine's%20article.pdf -- 94.0 Кб -- 24.08.2010
[
Текст
]
Ссылки http://suny.msu.ru/ru/Lavine's%20article.pdf -- 94.0 Кб -- 24.08.2010 Похожие документы