... About hotel . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... Great stay! dns_support@antihotmail.com . ... Great hotel! ... best place in Murmansk that I've stayed! Add me to your mailing list for special offers . ... Stay was great. ... Always nice to have a good nights rest while enroute to my destinations. ... Very nice place . ... What a beautiful place, we enjoyed our stay! ... Best place ever! ... Your hotel was so nice. ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
Lomonosov Moscow State University | pic] |Faculty of Biology | ... Application | ... Name | ... First Name | ... Other Names | ... Date of Birth | ... Place of Birth | ... Passport | ... Passport issued | ... City | ... 2.|e-mail | ... Faculty | ... Russian Consulate to be applied to for visa[1] |10.| City, state | ... The visa invitation supposes your stay in Moscow and a region adjacent to WSBS ONLY. ... 1] Cannot be changed after application ...
... Academic Programmes . ... Vestnik CIE (in Russian) . FAQs (in Russian) . ... About Moscow University . Links (in russian) . ... Test Your Russian ? ... Lomonosov Moscow State University . ... Day- -Month- -Year- . ... Choose- Male Female . ... Choose- -Other- . ... Russian language for academic purposes major subjects) . Course: . ... Choose- during academic year summer courses . ... Course dates: . ... Choose- professional training refresher course brief refresher course traineeship . ...
Nuclear Instruments and Methods in Physics Research B 150 (1999) 622±627 Roman mosaic glass : a study of production processes, using PIXE spectrometry S.J . Fleming a, C.P . Swann a b b,* MASCA, University of Pennsylvania Museum, Philadelphia, PA 19104, USA Bartol Research Institute, University of Delaware, Newark, DE 19716, USA Abstract The most attractive Roman glass produced during the early part of the 1st century A.D.. was ... Roman mosaic glass During the reign of Augustus (27 B . ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... Accommodation . ... Dubna & our Venue . ... All accommodation expenses are covered by Organizers . Hotel "Dubna" is located 7-10 minutes from the conference place. ... Please, come first to Registration desk at SINP, DB (Leningradskaya, 12). Call Organizers if you find nobody at the desk (phone numbers are available at the desk). Free Wi-Fi internet access will be available throughout the Hotel Dubna and at the Conference place (hall on the 2nd floor). ...
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
... It is far easier: to apply for that type of visa one needs a voucher that can be issued by any travel/tourist agency in your home country (but better select an agency recommended by the appropriate Russian Consulate; please note that a hotel reservation even supported by a letter of invitation from the conference organizers is not sufficient to apply for a tourist visa, it is a voucher that is requested). ... 6) After getting the form, one can apply for the Russian visa. ...
... About hotel . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... Great stay! dns_support@antihotmail.com . ... Great hotel! ... best place in Murmansk that I've stayed! ... Stay was great. ... Always nice to have a good nights rest while enroute to my destinations. ... Very nice place . ... What a beautiful place, we enjoyed our stay! ... Best place ever! ... Next time we visit Murmansk we will definitely stay in this hotel. ... Good ....
... A member of the Russian Academy ofsciences, a great physicochemist,and a world-renowned Professor Boris Vladimirovich Derjaguin died on May scientist, he laid the foundation of the modern science of colloids and surfaces. ... B. V. Derjaguin became known world-wide in scientific circles for his work on the stability of colloids and thin films of liquids which is now known as the DLVO theory, after the initials of its authors: Derjaguin, Landau, Verwey, and Overbeek. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Phys. 48 (2000) 5 ± 7, 637 ± 641 ± ± Generation of Entanglement in a System of Two Dipole-Interacting Atoms by Means of Laser Pulses I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Abstract Effectiveness of using laser field to produce entanglement between two dipole-interacting identical twolevel atoms is considered in detail. ... 6] R. G. Brewer, Phys. Rev. A 52 (1995) 2965. ...
... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . История ГАИШ и Московской обсерватории . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... Welcome to the Extra-galactic research group of SAI ! ... Sternberg Astronomical Institute is older than the entire field of extra-galactic astronomy. ... At the same time, the Extra-galactic astronomy group as an element of the institute structure remains the youngest subdivision of SAI. ... 2007, astro-ph/0709.3047 . ...
Draft Dr. Paul Twomey President and Chief Executive Officer Internet Corporation for Assigned Names and Numbers (ICANN) Speech to Third International Forum Partnership Among State, Business Community and Civil Society in Ensuring Information Security Garmisch-Partenkirchen, Germany Monday, 20 April 2009 Dear Vladislav Petrovich, Dear Alexei Anatolievich, Distinguished guests, Ladies and Gentlemen. ... ICANN itself is evolving, mirroring the changing nature of the global Internet community. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/twomey.doc -- 44.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/twomey.doc -- 44.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/twomey.doc -- 44.0 Кб -- 02.04.2012 Похожие документы
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...