Sbornik : Mathematics 201:3 117 Matematicheski Sbornik 201:3 320 i c 2010 RAS(DoM) and LMS DOI 10.1070/SM2010v201n03ABEH004074 Elementary equivalence of Chevalley groups over lo cal rings E. I. Bunina Abstract. It is proved that (elementary) Chevalley groups over local rings with invertible 2 are elementarily equivalent if and only if their types and weight lattices coincide and the initial rings are elementarily equivalent. ... Keywords: Chevalley groups, elementary equivalence, local rings. ...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:bunina_proofs.pdf -- 314.0 Кб -- 13.02.2013 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Аннотированные англоязычные сокращения . ... программа решения пятидиагональных несимметричных линейных систем со спектром, лежащим в полуплоскости Re; реализует алгоритм Мантеффеля; имеется возможность для ускорения сходимости использовать стабилизированное частичное LU - разложение матрицы системы; разработана в ACCU, Нидерланды . ... пакет программ для решения систем линейных алгебраических уравнений итерационными методами, разработанный в университете штата Техас в г.Остине, США . ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
Annu. ... Key Words stellar energy production, Nobel Prize, supernova, binary pairs s Abstract Astrophysics has been an important part of my personal and scientific life three times. ... Gamov suggested to one of his graduate students, Charles Critchfield, that he actually calculate the proton-proton reaction. ... In stars, the proton-proton reaction is usually followed by a chain of reactions with the end result of producing 4He. ... In 1938, they suggested energy production in stars. ...
Yakubovich (i) Professional preparation Olga Yakubovich 1967 1973 1973 1978 1996 (ii) Appointments MS in Geochemistry (cum laude), Moscow State University , Russia PhD in Crystallography and Crystal physics, Moscow State University , Russia Dr of Science in Geology and Mineralogy, Moscow State University , Russia 1997 present 1994 1997 1983 1994 1973 - 1983 Department of ...
Doxyfile 1.4.6-NO # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, .. ... USE_WINDOWS_ENCODING = YES # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). ... The default is NO. ...
... Результаты освоения ООП ВПО определяются приобретаемыми выпускником компетенциями, т.е. его способностью применять знания, умения и личные качества в соответствии с задачами профессиональной деятельности. ... иностранным языками как средством делового общения; | ... В курсе рассматриваются: | ... Management Group) унифицированного языка моделирования UML | ... С графической нотацией языка UML слушатели курса сталкиваются как пользователи CASE- инструментов при проектировании программных систем. ...
... Душа самосознающая / Сост. и вступ. ст. ... Москва и 'Москва' Андрея Белого: Сборник статей / Отв. ред. ... Единство моих многоразличий:' Неотправленное письмо Сергею Соловьеву / Публ., вступ. ст. и коммент. ... Серебряный голубь: Рассказы / Сост., предисл., коммент. ... Сост. ... Бердяев Н. Письма Андрею Белому / Предисл., публ. и примеч. ... Робакидзе Г. Письма Андрею Белому / Публ. и предисл. ... Предисловие' А.Белого к неосуществленному изданию романа 'Котик Летаев' / Публ., вступ. ст. и коммент...
Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...
... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2009. ... Solutions to the system of equations describing the propagation of hydraulic fracture cracks in a porous medium are obtained in the travelling wave form. The only sought solution is the separatrix of integral curves on the "penetration depth crack width" plane. Some necessary dependencies that should be given at the crack inlet are found for the fluid flow rate and the fluid pressure. ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...
[
Текст
]
Ссылки http://cytol.bio.msu.ru/docs/Information%20letter%202014-1.doc -- 215.0 Кб -- 19.03.2014 Похожие документы
CURRICULUM VITAE Nataliya V. Roznyatovskaya, Ph.D. Moscow State University Chemical Faculty, Department of Electrochemistry Vorob'evy Gory, MSU, 119992 Moscow Russia Tel: +7(495)-939-25-70, Fax: +7(495)-932-88-46 E-mail: natasha@elch.chem. msu.ru www. elch.chem. msu.ru/~natasha/ Personal: Born: December 27, 1979 (Moscow) Citizenship: Russian Family state: unmarried Education: 2002 Diploma in Chemistry from Moscow State University, Chemical Faculty, Department of Chemical Enzymology. ...
[
Текст
]
Ссылки http://www.elch.chem.msu.ru/~natasha/CV_Roznyatovskaya_pdf.pdf -- 24.8 Кб -- 22.03.2006
[
Текст
]
Ссылки http://electr003.chem.msu.ru/~natasha/CV_Roznyatovskaya_pdf.pdf -- 24.8 Кб -- 22.03.2006 Похожие документы
... On-line консультант . ... Title: Security and Privacy in Online Social Networks . ... Title: Вопросы Безопасности и Конфиденциальности в Современных Социальных Сетях . ... К примеру, в 2011 активисты "Арабской весны" использовали социальные сети как средство коммуникаций, а в 2012 году американский президент Обама во время перевыборных собрал $690 миллионов через социальные сети. ... Copyright ВМиК МГУ , 2008 . ...