... Scientist, Physics Department, M.V.Lomonosov Moscow State University . ... International Laser Center and Faculty of Physics . M.V.Lomonosov Moscow State University . Moscow 119899 . ... 2002-till now: Scientist at Physicw Faculty, M.V.Lomonosov Moscow State University . ... Quantum optics, confinement of particles in traps, laser-particles interactions in traps, computer simulation of laser-matter interaction . ... 2016 Quantum Information Laboratory. ...
... TernAPI program . ... TernAPI program is designed for ternapy phase diagrams calculation by means of the convex hull method. ... Quick calculation of isobaric-isothermal sections of ternary systems phase diagrams (1-30 sec.) ... Voskov A.L., Dzuban A.V., Maksimov A.V. TernAPI program for ternary phase diagrams with isolated miscibility gaps calculation by the convex hull method // Fluid Phase Equilib . ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...
... Chemical Enzymology Department, Chemical Faculty . The M.V. Lomonosov Moscow State University, Lenin's Hills, 1/11 Moscow 119991, Russia . ... Master's Degree, Honours Degree, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2009) . Diploma of technical translator - chemistry (Russian-English) (2008) . ... Ph.D. Student, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2009 - present time) . ...
... 2 · , , · · , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...
... H. Purcell: The Fairy Queen - Act III . ... Act II . ... Act III . Акт III . ... To charm him she transforms the scene into a great forest: fauns, dryads and fairies dance and sing about love until four green savages come and drive them away with an uproarious dance, Then the shepherd Coridon enters - he would like to steal a kiss from his escort Mopsa. ... Dance for the fairies . ... Four Savages enter, fright the Fairies away, and Dance an Entry. ... Dialogue between Coridon and Mopsa CORIDON . ...
Sbornik : Mathematics 201:3 117 Matematicheski Sbornik 201:3 320 i c 2010 RAS(DoM) and LMS DOI 10.1070/SM2010v201n03ABEH004074 Elementary equivalence of Chevalley groups over lo cal rings E. I. Bunina Abstract. It is proved that (elementary) Chevalley groups over local rings with invertible 2 are elementarily equivalent if and only if their types and weight lattices coincide and the initial rings are elementarily equivalent. ... Keywords: Chevalley groups, elementary equivalence, local rings. ...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:bunina_proofs.pdf -- 314.0 Кб -- 13.02.2013 Похожие документы
Аннотированные англоязычные сокращения . ... программа решения пятидиагональных несимметричных линейных систем со спектром, лежащим в полуплоскости Re; реализует алгоритм Мантеффеля; имеется возможность для ускорения сходимости использовать стабилизированное частичное LU - разложение матрицы системы; разработана в ACCU, Нидерланды . ... пакет программ для решения систем линейных алгебраических уравнений итерационными методами, разработанный в университете штата Техас в г.Остине, США . ...
News of PARALLEL.RU par-news на mail.parallel.ru . Вт Окт 2 11:30:47 MSK 2012 . Следующее сообщение: PARALLEL.RU - Новости, выпуск #334 [16/10/2012] . ... Выпуск 333 . 2 октября 2012 г. ------------- 12 октября 2012 года заканчивается прием заявок на конкурс прикладных разработок и исследований в области компьютерных технологий Компьютерный континуум: от идеи до воплощения , проводимый корпорацией Intel и Фондом развития инновационного центра Сколково . http ://ru ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Результаты освоения ООП ВПО определяются приобретаемыми выпускником компетенциями, т.е. его способностью применять знания, умения и личные качества в соответствии с задачами профессиональной деятельности. ... иностранным языками как средством делового общения; | ... В курсе рассматриваются: | ... Management Group) унифицированного языка моделирования UML | ... С графической нотацией языка UML слушатели курса сталкиваются как пользователи CASE- инструментов при проектировании программных систем. ...
... Душа самосознающая / Сост. и вступ. ст. ... Москва и 'Москва' Андрея Белого: Сборник статей / Отв. ред. ... Единство моих многоразличий:' Неотправленное письмо Сергею Соловьеву / Публ., вступ. ст. и коммент. ... Серебряный голубь: Рассказы / Сост., предисл., коммент. ... Сост. ... Бердяев Н. Письма Андрею Белому / Предисл., публ. и примеч. ... Робакидзе Г. Письма Андрею Белому / Публ. и предисл. ... Предисловие' А.Белого к неосуществленному изданию романа 'Котик Летаев' / Публ., вступ. ст. и коммент...
... NUCLEI, PARTICLES, FIELDS, GRAVITATION, AND ASTROPHYSICS Wavelet Analysis of Fine-Scale Structures in the Saturnian B and C Rings Using Data from the Cassini Spacecraft E. B. Postnikova and A. Yu. ... These factors are especially important for the fine-scale structure of Saturn's A ring. ... The efficiency of the wavelet transform with a simple Morlet wavelet basis in solving this task was successfully demonstrated by our study of resonance structures in Saturn's A ring [10]. ...
May 12, 1998 NOTES from May 9, 1998: The format of the Solar Event Lists was changed to include a standard SEC style header. ... Please send comments and suggestions to sec@sec.noaa.gov # # Missing data: //// # # Edited Events for 1998 May 11 # # Event Begin Max End Obs Q Type Loc/Frq Particulars Reg# #------------------------------------------------------------------------------- 2560 A0146 //// 1225 HOL ... The UT day of the event's begin time is the UT day of the list. ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...
[
Текст
]
Ссылки http://cytol.bio.msu.ru/docs/Information%20letter%202014-1.doc -- 215.0 Кб -- 19.03.2014 Похожие документы
... За последние несколько лет члены GMRG опубликовали множество значимых работ, в том числе антологию The Discourses and Politics of Migration in Europe (Palgrave, 2013), статьи в Journal of European Public Policy и специальный выпуск Comparative European Politics (2015), посвященный крупным политическим партиям и миграционной политике в Европе. ... Bucken-Knapp G., Hinnfors J., Spehar A. Political Parties and Migration Policy Puzzles // Comparative European Politics. ... Bucken-Knapp G. Book Review. ...
... On-line консультант . ... Title: Security and Privacy in Online Social Networks . ... Title: Вопросы Безопасности и Конфиденциальности в Современных Социальных Сетях . ... К примеру, в 2011 активисты "Арабской весны" использовали социальные сети как средство коммуникаций, а в 2012 году американский президент Обама во время перевыборных собрал $690 миллионов через социальные сети. ... Copyright ВМиК МГУ , 2008 . ...