pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...
... M.V.Lomonosov Moscow State University, . ... Graduate Student, Physical Chemistry Division, Department of Chemistry, M. V. Lomonosov Moscow State University (since 1997) . M. Sc. in Chemistry, Department of Chemistry, M. V. Lomonosov Moscow State University (1997), Thesis: "Modelling of Structure and Spectra of Van-der Waals complexes (HF) 2 Ar n ,n=1-20". ... Moskovsky A.A. Nemukhin A.V. Modeling solvation sites in rare-gas matri-ces with the simulated annealing Monte Carlo technique PDF,402 K . ...
I was born on April 12, 1958, in Moscow, USSR, and I have a Russian nationality. I graduated the Lomonosov Moscow State University in 1981, obtained there my Ph.D.degree in 1984 (the topic of the dissertation: "Stellar populations and evolution of galaxies") and a degree of Doctor of Physical-Mathematical Sciences in 1994 (the dissertation "Stellar population of galactic nuclei"). Since 1984 I hold a permanent position at the Sternberg Astronomical Institute (Moscow). ...
Graduated from Chemical Department, Moscow State University (1997), post-graduate student of Department of Electrochemistry , Chemical Faculty, MSU. ... 1991-1997 - Chemical Faculty, Moscow State University. 1997 - Graduated from Chemical Department, Moscow State University. since 1997 - post-graduate student of Department of Electrochemistry , Chemical Faculty, MSU. ... G.A.Tsirlina, S.N.Pron'kin, F.M.Spiridonov, S.Yu.Vasiliev, O.A.Petrii, Rus.J.Electrochemistry , 1994, 30 , 236 . ...
... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/9af64c1c38133e2400976ad6af22fd1007e46b3e?vid=21924&disposition=attachment&op=download -- 283.0 Кб -- 01.10.2012 Похожие документы
... V.A.Makarov, V.O.Militsyn, S.A.Shlenov, V.V.Shuvalov, D.N.Yanyshev, "Developing of multimedia lectures on laser physics with the help of flash-technologies", Physics in Higher Education, 11 (2) (2005). ... 4750 , "ICONO 2001: Quantum and Atomic Optics, High-Precision Measurements in Optics, and Optical Information Processing, Transmission, and Storage", S.N.Bagayev, S.S.Chesnokov, A.S.Chirkin, and V.N.Zadkov, Eds, pp.104-110 (2002). ... 2016 Quantum Information Laboratory. ...
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 1967-1972: Undergraduate: M.V. Lomonosov Moscow State University, Department ofТљMechanics and Mathematics. ... 1980-1987: The Deputy Dean for science and research, Department ofТљMechanics and Mathematics, M.V. Lomonosov Moscow State University . ... 1997-2001: The Deputy Minister ofТљthe Education ofТљthe Russian Federation . ... since 2003: Head ofТљDepartment ofТљMechanics, Steklov Mathematical Institute, Russian Academy ofТљSciences . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...
Страница поддержки курса "Архитектура ЭВМ и язык ассемблера" для 1 потока . ... Ассемблер nasm . ... Программа курса . ... Компьютерные системы: архитектура и программирование. 1 издание . ... Итоги коллоквиума ?1 . ... Коллоквиум ?1 . ... Итоги экзамена и всего курса . ... Результаты коллоквиума ?1 . ... Older posts . Posted on 05.04.2016 by vartan . ... 5) Записать на языке ассемблера выражение с побочными эффектами, заданное на языке Си . ... Архитектура ЭВМ и язык ассемблера . ...
Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...
... 2013 тАФ Academic Writing: Russian and International Experience (Moscow) . ... 2009 тАФ Media Imagination (Moscow) . 2008 тАФ University Among the Media: Innovation in Higher Learning and Changing Modes of Effective Communication (Moscow) . ... 2003 тАФ Reading Everyday Life in American and in Russian: Semiotics of Culture and Intercultural Communication (Yasnaya Polyana) . 2002 тАФ Popular Literature: American and Russian Experience in Cultural Myth-Making (Moscow) . ... Summer School 2016 . ...
Вы посетили: grants_engl.html . ... История кафедры . ... 2010 RFBR (Russian Fond of Basic Researches) 08-01-00693, 09-01-00303 . President of Russia Young Scientist Fellowship MD-2535.2009.1 . ... President of Russia Young Scientist Fellowship MK-2718.2007.1 . ... President of Russia Young Scientist Fellowship MK-1417.2005.1 . ... INTAS Young Scientist Fellowship 03-55-1919 . ... staff/guterman/grants_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...
... Official address of the Faculty of Materials Science: . Leninskie gory 1, building 73, Lomonosov Moscow State University, Faculty of Materials Science, 119991 Moscow, Russia . Education Office . ... office 214, lab building B (bld. ... Tel: +7 (495) 939-45-51 . Fax: +7 (495) 939-09-98 . office . 237, lab building B ( bld . ... office 546, chemistry building (bld. ...
... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...