... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog

Welcome to the site of the Laboratory of Mathematical Models of Quantum Scattering Processes . ... It develops mathematical models of ionizing collisions in atomic, molecular, and condensed matter physics. Main areas of current research activity include single and multiple ionization by electron, ion, and photon impact, ionization processes in strong laser pulses, and laser-assisted ionizing collisions. ... Research | ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>13) - lmmqsp.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the proteinґprotein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>38) - www.library.biophys.msu.ru/ )

• http://www.library.biophys.msu.ru/PDF/80522.pdf
• http://www.library.biophys.msu.ru/PDF/80521.pdf
• http://www.library.biophys.msu.ru/art004/article.pdf

The laboratory is engaged in fabricating high-efficiency catalysts and working out theoretical descriptions of kinetics and mechanisms of the processes which takes place in chemical power sources. ... The kinetics of electrooxidation of some simplest organic fuels is investigated, which is of interest for electrochemical generators. ... B.I.Podlovchenko, E.A.Kolyadko, Lu Shigan, Specific Features of Hydrogen Sorption by Pd Dispersed Forms at a-Phase Potentials // J.Electroanal. ...

Еще в разделе: (Показать все результаты (>19) - www.elch.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>11) - lcc.chem.msu.ru/ )

... Vol. ... Translated from Biofizika; Vol. ... CELL BIOPHYSICS Effects of Electric Field on Spatiotemporal Patterning in the Reaction-Diffusion System A. I. Lobanov-, T. Yu. ... Abstract-A model is proposed that describes electrodiffusion in the layer adjacent to the cell membrane. The model takes into account chemical reactions at the membrane, Coulomb interactions between particles, their random motion (diffusion), and the effect of an external electric field. ... BIOPHYSICS Vol. ...

Еще в разделе: (Показать все результаты (>35) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3341.pdf
• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/PDF/3340.pdf

... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...

Еще в разделе: (Показать все результаты (>19) - www.protein.bio.msu.ru/ )

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts

. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>10) - www.biophys.msu.ru/ )

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>20) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/CC_EF1f.doc
• http://beams.chem.msu.ru/sotrudniki/larin/IJIM99.pdf