... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

... Twenty five years ago the first Russian papers dedicated to Surface Nonlinear Optics were published. This 25th anniversary allows us to look back on the early 1980s, the time of appearance of Surface Nonlinear Optics as a branch of Optics. Pioneering works by Prof. Y.R. Shen in the early 1980s, which were based on the 1960s fundamental ideas of Prof. N. Bloembergen, stimulated an explosion of such studies at Moscow State University and around the world. ... March 2008 ...

Еще в разделе: (Показать все результаты (>16) - shg.phys.msu.ru/ )

• Publications Keywords Search
• Introduction

... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

... lang=='en'?' ... Скачать...') .' '; if ($lang == 'en') { block($dscs[$id]['encap'], date('Y/m/d h:i A', $dscs[$id]['time']).' | ... удалить ', $s); } } } function drawfolder($id) { global $flds; global $lang; if (isset($flds[$id])) { $s = ' . ... Open':'Открыть') .' '; if ($lang == 'en') { block($flds[$id]['encap'], date('Y/m/d h:i A', $flds[$id]['time']).' | ... удалить ', $s); } } } function drawparent($id) { global $flds; global $lang; if (isset($flds[$flds[$id]['parent']])) { $s = ' . ...

Еще в разделе: (Показать все результаты (>2) - osa.phys.msu.ru/ )

• http://osa.phys.msu.ru/a_news.php

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>36) - acoustics.phys.msu.ru/ )

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...

Еще в разделе: (Показать все результаты (>4) - www.biophys.msu.ru/ )

• Technical Specifications
• Устинин Дмитрий Михайлович

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15614 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Наследие Востока . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Kraftwerk . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...

Еще в разделе: (Показать все результаты (>13) - www.bukivedi.ru/ )

• www.99ru.ru - Radiohead 15841
• www.99ru.ru - Jethro Tull 15531

Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...

232. Index of /modules/ax_content/atomax/spaw/lib/themes/default/img

233. Успешные примеры использования

234. Introduction to quantum physics | Department of Quantum Electronics

235. http://erg.biophys.msu.ru/erg/wordpress/wp-content/uploads/2010/04/jse_04_2_schmidt.pdf

236. О кафедре ? Кафедра суперкомпьютеров и квантовой информатики

237. MSU Science Park - Companies

238. Интернет

239. Information Resources at SINP MSU

240. А.В.Засов. Задача 14: Определение цвета и морфологического типа удаленной