... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...

Еще в разделе: (Показать все результаты (>33) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2001_RadialMaze.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Rostov_Varifoc.doc

... Probe flash (energy/duration) . ... 0.01 J / 0.01 ms . ... Submersible unit (dimension/weight) . Power supply unit (dimensions/weight) . ... 300 x 300 x 50 mm / 1 kg . ... Power supply . ... The complete set of PrimProd fluorometer consists of the following mainframes: submersible probe, 12 DC on-board block power supply, IBM-compatible computer, connecting cables and cable-rope. ... Submersible probe. ... On-board power block provides the necessary voltage (42 V) supply at the submersible probe. ...

Еще в разделе: (Показать все результаты (>12) - www.biophys.msu.ru/ )

• Как отмечалось выше, обилие (по Fo) и фотосинтетическая активность
• Сектор информатики и биофизики сложных систем
• (Chlorophyll Fluorescence in vivo: A Theory

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>10) - www.sciencepark.ru/ )

• MSU Science Park - News

... Область ПЛИС-компьютеров является достаточно молодой и бурно развивающейся в настоящее время. ... CLB (Configurable Logic Blocks) - программируемый логический блок, часть FPGA-устройства, предназначенная для программирования некоторой функции или ее части. ... FPSC (Field Programmable System Chip) - устройство, представляющее собой объединение на одном кристалле FPGA и встроенного ASIC -ядра. ... PLA (Programmable Logic Array) - программируемые логические устройства наподобие ППЗУ . ...

Еще в разделе: (Показать все результаты (>6) - fpga.parallel.ru/ )

• Строение и история развития микросхем с реконфигурируемой архитектурой

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>7) - npidb.belozersky.msu.ru/ )

... Unemployment of graduates combined with a shortage of highly educated young people is putting the European governments under pressure to act. ... The Bologna Declaration explicitly mentions the lack of competitiveness of European Higher Education institutions. The signatory countries actually explicitly express their goal to "ensure that the European higher education system acquires a world- wide degree of attractiveness equal to [Europe's] extraordinary cultural and scientific traditions". ...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

... ESA Space Weather Activities | ... Space Environments and Effects Analysis Section, | ... Introduction THE NATURAL SPACE ENVIRONMENT REPRESENTS A CONSIDERABLE HAZARD FOR SPACECRAFT AND THE EUROPEAN SPACE AGENCY (ESA) HAS FOR MANY YEARS TAKEN MEASURES TO ENSURE THAT ITS SPACECRAFT ARE ABLE TO SURVIVE AND OPERATE IN IT. ... 2.2 Radiation Effects As in other space agencies, ESA's concerns with space weather effects probably began with concerns over radiation effects on spacecraft systems. ... 2000). ...

Еще в разделе: (Показать все результаты (>109) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/pdf2/cosr560_1.pdf
• http://www.kosmofizika.ru/buri/geostorm.pdf
• L.Lazutin, List of publications

... info@ecfs.msu.ru . ... Topic 2: Barriers to Sustainable Soil.. ... We are inviting you to participate in our consultation on "Barriers to Sustainable Soil Management in Eurasia and possible ways for overcoming them".љ ... Is workforce capacity in the Eurasian region sufficient for adopting sustainable soil management practices? ... Мы приглашаем вас принять участие в нашей консультации "Барьеры на пути к устойчивому землепользованию в Евразии и возможные пути их преодоления".љ ... Topic 2 . ...

Еще в разделе: (Показать все результаты (>17) - ecfs.msu.ru/ )

• Topic 1: Building the Eurasian Food Security Network / Создание Евразийской
• Online Consultation on Network and Partnerships in the area of Food Security |

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... Новости События Объявления Информация Публикации Архив документов Научная деятельность . ... Об издательской деятельности Каталог книг Вестник Московского университета Авторам Содержание выпусков Электронный журнал Проектная деятельность . ... Панченко М.Ю. Межпарадигмальный подход к изучению проблемы управления региональным международным порядком . ... Sazhina M.A. Forngmation of State Anti-Recission Policy in Modern Conditions of Financial and Economic Instability . ... ФГУ МГУ 2016 . ...

Еще в разделе: (Показать все результаты (>54) - www.spa.msu.ru/ )

• The 14th International Conference 'Public Administration of the Russian

... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...

Еще в разделе: (Показать все результаты (>2) - np-chair.sinp.msu.ru/ )

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>12) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>4) - cell.biophys.msu.ru/ )

• CellBioph/People

. Коуровская тетрадь . Новосибирск . Another list of open problems . New York .

Еще в разделе: (Показать все результаты (>15) - halgebra.math.msu.su/ )

• staff:guterman:conf_engl.html | Кафедра высшей алгебры
• staff:guterman:conf_rus.html | Кафедра высшей алгебры
• staff:guterman:publ_engl.html | Кафедра высшей алгебры

... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...

Еще в разделе: (Показать все результаты (>18) - master.sai.msu.ru/ )

• Conference program
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...

Еще в разделе: (Показать все результаты (>4) - sun.sai.msu.ru/ )

Science . ... For 1st and 2nd-year students . Introduction to quantum physics . ... 2nd-year course work topics . ... For the history of our department a formal reference point is 1978 , when as a result of the reorganization of the Department of Wave Processes in the Physics Department of Moscow State University have two new departments : General Physics and Wave Processes ( OFVP ) and our department (up to 2001 - quantum physics, in 2001 renamed the Department of Quantum Electronics). ...

238. CURRICULUM VITAE

239. JCatalog >> Journal information >>

240. Лаборатория геометрических методов математической физики.