. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
МГУ имени М.В.Ломоносова Русская версия . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... 15 Apr 2016 . ... 2016 . Отправить сообщение Посмотреть контакты . Delete from contacts . Add to сontacts . ... Филиал Московского государственного университета имени М.В.Ломоносова в г.Ташкенте, Ташкент, Узбекистан . ... Московский государственный университет имени М.В.Ломоносова, Москва, Россия . ... МГУ имени М.В. Ломоносова . ...
You are here: Foswiki > System Web > ReferenceManual > DeveloperDocumentationCategory > PerlDoc (19 Apr 2011, ProjectContributor ) E dit A ttach . ... Foswiki::Configure::UIs::AUTH - Specialised UI for the AUTH screen. ... Foswiki::Configure::UIs::CGISetup - Specialised UI for the CGI Setup section. ... No special UI behaviour is required - it's just a simple section with standard Value types in the model. Foswiki::Configure::UIs::MSWin32 - Specialised UI for the MSWin32 checks. ... System . ...
... структурная морфология растений, морфология цветка, теоретическая ботаника, биотехнология (клональное микроразмножение in vitro ). ... Чуб В.В. 'Роль позиционной информации в регуляции развития органов цветка и листовых серий побегов'. ... Чуб В.В., Юрцева О.В. Математическое моделирование формирования цветка у представителей семейства Polygonaceae. ... Choob V.V., Penin A.A. Structure of Flower in Arabidopsis thaliana : Spatial Pattern Formation// Russian Journal of Developmental Biology (Ontogenez...
Клуб выпускников МГУ (Московский Государственный Университет) . By national TV "NEW CHANNEL", UKRAINE. New quantum technology in the field of biocybernetics . ... NEW CYBERNETIC BODY WITH THE BEST QUALITY OF REAL LIFE. ... B контексте моей теории плазма, это не ионизированный газ, а форма материи, из которой состоит внутренняя структура частиц. ... NEW QUANTUM THEORY OF ATOM'S NUCLEUS PRESENTED BY THE AUTHOR, DR. KOSTIANTYN RASIN. ... NEW ERA OF QUANTUM TECHNOLOGIES JUST BEGUN.. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Продолжены теоретические и экспериментальные исследования динамики поляризации излучения иттербиевого волоконного лазера с двойной оболочкой. ... International Conference Laser and Laser-information technologies: fundamental problems and Applications, ILLA 2006, p.83. ... Dynamical characteristics of generation of two-frequencies lasers with orthogonal polarizations //Proceedings of 8th International Conference on Laser and Fiber-Optical Networks Modeling, LFNM-2006, Kharkiv, Ukraine, July, 2006, pp...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
ВМиК-Online! ... Новости . Факультет . ... Конференции . ... 06.09.2003 . 5 сентября на факультете вычислительной математики и кибернетики Московского университета открылась 13-ая Международная конференция по компьютерной графике и визуализации GraphiCon?2003 . GraphiCon ? ... 5 и 6 сентября ? ... Начиная с 8 сентября на GraphiCon?2003 будут проводиться доклады, презентации, мультимедиа-программы и др. ... Работа GraphiCon?2003 продлится до 10 сентября. ... 2001 2012 ВМиК Online! ...
Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...
... Спецкурсы | ... История . ... Введение в языкознание . Общее языкознание . История языкознания . ... Русский язык как иностранный . ... Компьютерная лингвистика и машинный перевод . ... What does the term "Applied Linguistics" stand for. ... Terminological science as a very important domain of the applied linguistics. ... Informatization of modern society and applied linguistics. ... Prospects of the development of applied linguistics and its interactions with theoretical linguistics. ...
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
Summary Progress Report 2010 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf -- 1926.1 Кб -- 13.09.2014 Похожие документы
Сайт кафедры биофизики физического факультета МГУ . ... Студентам . ... Программы курсов . ... Кафедра биофизики поздравляет студентов и сотрудников с началом 2015-2016 учебного года! ... Кафедра биофизики продолжает работу семинаров для студентов младших и старших курсов . ... Выступление Свешниковой А.Н. љ Семинар для студентов 1-2 курсов БИОФИЗИКА: 21 ВЕК 13 апреля 2016 г. (в СРЕДУ) в 15-20 (ауд. 5-68) к.ф.-м.н. Свешникова А.Н. "Что такое Systems Biology? ... Межфакультетский курс "Биофизика". ...