. Название публикации . Nuclear Magnetic Resonance Spectroscopy in Solving the Analytical Problems of Medicine: Analysis of Cerebrospinal Fluid . Авторы . T.N. Kolokolova, O.Yu. Savel'ev, N.M. Sergeev, O.A. Shpigun, K.V. Sokolov, V.I. Skvortsova . Дата . 31.12.2009 23:00:00 . Название журнала . Journal of Analytical Chemistry. Том . Vol.65 . Номер . 10. первая страница . 1073 . последняя страница . 1081. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>8) - fbm.msu.ru/ )

XXI ) : 23.00.02 - , - 2015 « ». ... 1992. ­ 3. ­ . ... 2000; . ... 5; Beck U. World Risk Society. ... Cambridge, 1990; Luhmann N. Risk: A Sociological Theory. ... Modern Political Analysis. ... Risk Management and construction. ... New York: McGraw-Hill, 2000; Charles R. Kennedy (1988), "Political Risk Management: A Portfolio Planning Model," Business Horizons, 31(6); Carlson, Sunne. ... Published by Routledge, 2009. ­ 304 p.; Brink, Charlotte H. Measuring political risk: risks to foreign investment. ...

Еще в разделе: (Показать все результаты (>32) - www.spa.msu.ru/ )

Cosmic Research, Vol. 42, No. 5, 2004, pp. 489­534. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 509­554. Original Russian Text Copyright © 2004 by Panasyuk, Kuznetsov, Lazutin, Avdyushi, Alexeev, Ammosov, Antonova, Baishev, Belenkaya, Beletsky, Belov, Benghin, Bobrovnikov, Bondarenko, Boyarchuk, Veselovsky, Vyushkova, Gavrilieva, Gaidash, Ginzburg, Denisov, Dmitriev, Zherebtsov, Zeleny, Ivanov-Kholodny, Kalegaev, Kanonidi, Kleimenova, Kozyreva, Kolomiitsev, Krasheninnikov,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/vesel2.pdf

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>6) - www.bio.msu.ru/ )

• Master In Ecology ? Биологический факультет МГУ
• The Second White Sea Molecular Zoology Summer School ? Биологический факультет

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...

Еще в разделе: (Показать все результаты (>16) - hea.phys.msu.su/ )

• About this Conference System

... Advance Conference Program . Advance Conference Program is available for download below: . б б б б б б б б б б б б б б б б б б  ICONO-LAT-2013-program.pdf . Conference Technical Digest . The Conference Technical Digest, which is distributed among the conference participants on CD ROM, is available for download from the link below: . б б б б б б б б б б б б б б б б б б  icono-lat-2013-technical-digest.zip . ... Advance program . ... Registration info . ... Contacts . ... Exhibit . ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

• Invited speakers

... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf
• http://ocean.phys.msu.ru/courses/stathyd/2002%20Smyth%20et%20al.%2C%20Shear%20instability%20and%20gravity%20wave%20saturation%20in%20an%20asymmetrically%20stratified%20jet.pdf
• http://ocean.phys.msu.ru/science/nosov/EGU2011_tsunami%20vs%20eq.pdf

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>4) - textbook.sinp.msu.ru/ )

... 5-th All-Russian Conference . ... 12.00 - 14.25 Epitaxy of III-N materials . 12.00 - 12.15 III-N LEDs ON SiC SUBSTRATES. ... 12.15 - 12.30 EFFECT OF PARASITIC CHEMISTRY IN AlGaN MOVPE . A.V. Lobanova, E.V. Yakovlev, R.A Talalaev . 12.30 - 12.45 NON-POLAR a-(In)GaN HETEROSTRUCTURES . ... 16.00 - 16.15 InGaN QW WITH HIGH PHOTOLUMINESCENCE EFFICIENCY IN THE 490-630 nm RANGE, GROWN BY MBE PA ON с-Al 2 O 3 . ... Expirience of utilization D-180 (VEECO) setup for growth InGaN/GaN LED structures . ...

231. DEPRON | Университетский спутник "Ломоносов"

232. http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf

233. depozitariy | Living systems depository "Noah's Ark"

234. staff:guterman:autobio_engl.html | Кафедра высшей алгебры

235. Кривоножко Владимир Егорович | Кафедра НДСиПУ

236. http://www-hep.sinp.msu.ru/hep/images/stories/lehep_otchet_2009.doc

237. Поведенческие реакции рыб на болевые стимулы

238. Welcome! | Chair of Computer Methods of Physics