... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>13) - lcc.chem.msu.ru/ )

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ґ computer related 1) Ї Perform simulation , create trajectory file Ї Calculate properties timestep by timestep 2) Ї Perform ...

Еще в разделе: (Показать все результаты (>7) - www.elch.chem.msu.ru/ )

• Molecular aspects of solid state and interfacial electrochemistry

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>50) - brain.bio.msu.ru/ )

... CVS . ... ASM Kislovodsk . ... Anonymous CVS access through CVS protocol: . cvs -d :pserver:anonymous@curl.sai.msu.ru:/srv/cvs/cvsroot . Anonymous CVS browse through ViewVC: . ... Rs485 CVS . ... ASM Dome demon CVS . ... CVSROOT at curl.sai.msu.ru is located in /srv/cvs/cvsroot . You may access to CVS repository via SSH only using your curl's account login/password. ... export CVSROOT=curl.sai.msu.ru:/srv/cvs/cvsroot . ... CVS_RSH=ssh cvs -d user@ curl.sai.msu.ru:/srv/cvs/cvsroot command . ...

Еще в разделе: (Показать все результаты (>23) - curl.sai.msu.ru/ )

... About hotel . ... Contacts . ... The hotel т??69th Parallelт?? is glad to present its renewed website which now has an option of online booking! ... Reception . ... 8152) 25-37-00 . ... Bus number 106 (the last stop), then - from the stop "Railway Station Square" (near the pavilion with flowers) to stop the "Valley of coziness" bus number 1 or number 61 shuttle . From the railway station (bus stop "Railway Station Square" - near the pavilion with flowers to stop the "Valley of coziness"): . ...

Еще в разделе: (Показать все результаты (>2) - www.69parallel.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>4) - pk.math.msu.ru/ )

• Mechmath admission for internetional students

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

Review articles SINE insertions: powerful tools for molecular systematics Andrew M. Shedlock 1,2 and Norihiro Okada1* Summary Short interspersed repetitive elements, or SINEs, are tRNA-derived retroposons that are dispersed throughout eukaryotic genomes and can be present in well over 104 total copies. ... 2A), only one or perhaps a few highly active "master" SINE loci are capable of amplification, giving rise only to non-propogating offspring copies. ... 4) Independence of SINE insertions. ...

Еще в разделе: (Показать все результаты (>48) - vertebrata.bio.msu.ru/ )

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>21) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>5) - lmmqsp.sinp.msu.ru/ )

General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...

Еще в разделе: (Показать все результаты (>21) - site2010.sai.msu.ru/ )

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>11) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>6) - mph.cmc.msu.ru/ )

... Abstracts . ... Accomodation . ... Experiments and models. The connection between them is the reflection of model characteristics on the class of measurable quantities: positions of spectral bands and lines. ... Models ambiguity. ... Modern design methods (modern methods of calculation). Quantum beatings. abstract (PDF) . 2007 Biophysics dep., ...

Еще в разделе: (Показать все результаты (>40) - www.msm.biophys.msu.ru/ )