... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>3) - lcc.chem.msu.ru/ )

PHYSICAL REVIEW A 73, 063810 2006 Polarization states of four-dimensional systems based on biphotons Yu. ... Another disadvantage of using polarization qutrits rises from the fundamental impossibility to switch between arbitrary qutrit states using SU 2 optical elements, like retardation plates, rotators, etc. ... II we discuss the main properties of ququarts that are generated using the polarization state of the two-photon biphoton field. ... That subset of states was used to be reconstructed. ...

Еще в разделе: (Показать все результаты (>58) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2005-jetp(e)-100-521.pdf
• http://qi.phys.msu.su/papers/2007-jetp(e)-104-30.pdf
• http://qi.phys.msu.ru/kulik/Papers/e011802.pdf

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>4) - pk.math.msu.ru/ )

• IX Festival of Science | Mechmath admission for internetional students

... The Science Operation Department is composed of Astronomers, Telescope Instruments Operators(TIOs) and Data Handling Administrators(DHAs). ... Astronomers have proposed several methods to quantitatively measure the amount of turbulence above the telescope, which the most common ones is Differential Image Motion Monitor (DIMM). In optical testing, the Hartmann test is the common method to test the quality of optical components. ... Hartmann mask consists of 48 lenses. ...

Еще в разделе: (Показать все результаты (>13) - site2010.sai.msu.ru/ )

• General information

Текст подпрограммы и версий ( Фортран ) . ... Подпрограмма - функция SFG6R вычисляет неполную бета - функцию I x (a, b) = B x (a, b) / B(a, b) = x = 1/ B(a, b) т t a -1 (1 - t) b -1 dt 0 . ... FUNCTION SFG6R (X, A, B, EPS, ITMAX, IERR) . ... EPS - . ... В SFG6R и SFG6D используются рабочие подпрограммы - функции SFG6R1 и SFG6D1 соответственно COMMON /SFG6R2/ ITREAL X = 0.6 A = 16.0 B = 10.5 EPS = 0.000001 ITMAX = 100 RES = SFG6R(X, A, B, EPS, ITMAX, IERR) Результаты: RES = 0.47322 IERR = 0 ITREAL = 7 ...

Еще в разделе: (Показать все результаты (>5) - www.srcc.msu.ru/ )

• Журнал Московской Патриархии 12-2002

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>18) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

... Opportunities for Research Section Financial and Legal Mechanisms for Developing Russia in the Context of Global Political and Economic Instability Chairperson: Professor Alla Bobylyova Head, Department of Financial Management, School of Public Administration Lomonosov Moscow State University Secretary: Olga Lvova Department of Russian History, School of Public Administration Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>16) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/nautchnaja_dejatelnost/fortin_abstract.pdf

... Monshausen G*, Bibikova TN*, Shi C, Weisenseel M, Gilroy S (2007) Oscillations in extracellular pH and reactive oxygen species modulate tip growth of Arabidopsis root hairs. ... Vincent P, Chua M, Nogue F, Fairbrother A, Mekeel H, Xu Y, Allen N, Bibikova TN, Gilroy S, Bankaitis VA (2005) A Sec14p-nodulin domain phosphatidylinositol transfer protein polarizes membrane growth of Arabidopsis thaliana root hairs. ... Bibikova TN, Gilroy S (2008) Role of calcium in root hair growth and development. ...

Еще в разделе: (Показать все результаты (>3) - plantphys.bio.msu.ru/ )

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

234. http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf

235. http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf

236. http://www.elch.chem.msu.ru/mole/lecture/probst.pdf

237. CDFE provides the major photonuclear databases. Online Services.

238. Semantic Resources for Textual Content Compression

239. http://master.cmc.msu.ru/files/elbrus2000.pdf

240. Laboratory of Micro- and Nanofluidics