Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>8) - npidb.belozersky.msu.ru/ )

RUSSIAN version . ... Sergei V. OGURTSOV . ... In 2002-2009 worked as a research scientist in the Department of Vertebrate Zoology of the Faculty of Biology MSU. Ph.D thesis entitled 'Learning the native pond odour as one of the mechanisms of chemosensory orientation of anuran amphibians' at Faculty of Biology MSU in 2004. ... Ogurtsov S.V., 2004. Olfactory orientation in anuran amphibians // Russian Journal of Herpetology, V. 11, ?1, p. 35-40. [download pdf-file] . Ogurtsov S.V., 2005. ...

Еще в разделе: (Показать все результаты (>60) - vertebrata.bio.msu.ru/ )

• А.В.Бушуев

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>11) - swx.sinp.msu.ru/ )

... Kkimiya UDC 547.821 DATABASE COVERING THE SYNTHESES OF PYRIDINE S FROM ACYCLIC REAGENTS: THE ROLE OF NONSTANDAR D RETRIEVAL REQUESTS I N DEVELOPING THE STRATEGY OF COMPUTER SYNTHESIS E. V. Babaev and S. V. Tsitovskii Th e methodolog y o f constructin g a databas e covering th e synthese s o f pyridin e ring i n a standar d ChemBas e shel l i s discussed . ... Double lines in the diagrams correspond to the skeleton bonds of the reagents that pass into the skeleton of the pyridine cycle. ...

Еще в разделе: (Показать все результаты (>118) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/154e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/032e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/Eurasia/000.pdf

... Final Tests: December 01 - 25 . Final Examinations: January 03 - 25 . ... Final Tests: May 05 - 25 . Final Examination: June 01 - 25 . ... Students must pass all tests before taking the examinations. ... Preparatory Russian language course and major subjects at CIE from September to June ( see table below ). ... Accommodation in student dormitories from $165 per month (depending on living conditions). ... 203 000 . 20 300 . ... Please don?t hesitate to contact us for further information. ...

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

• A GLIMPSE BACK INTO THE HISTORY
• Postdoctoral training (Neutronography)

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>12) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>8) - www.cmc-online.ru/ )

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>17) - sbmg.geol.msu.ru/ )

... Chemical Department . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... 1999 - 2004 . Master's Degree, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2004) . ... Strong background in Chemistry (Biochemistry, Organic chemistry, Analytical chemistry, Inorganic chemistry, Physical chemistry, Chemistry of polymers, Radio-chemistry), biochemistry, molecular biology, Physics (course of Theoretical physics, the Theoretical mechanics) . ...

Еще в разделе: (Показать все результаты (>128) - www.enzyme.chem.msu.ru/ )

• Group of microbial biochemistry and biotechnology
• Kalyuzhnyi-E

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... N 1 Contents Buzhilova A.P. Anthropology at the Moscow University (to the 90 anniversary of Institute of Anthropology of the Moscow State University) (p. 4) Review. Historical development of the main trends in scientific research of the Institute and Museum of Anthropology, Lomonosov Moscow State University, is discussed. ... The article discusses the formation and development of ethnic anthropology in the Research Institute of Anthropology, Lomonosov Moscow State University from 1922 onwards. ...

Еще в разделе: (Показать все результаты (>29) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_4.doc

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>16) - curl.sai.msu.ru/ )

... Laboratory staff participate in the RFBR grant 14-01-00420-аА in 2014-2016. Laboratory staff participated in the RFBR grant 11-01-00523-аА in 2011-2013. ... A. Galstyan participated with poster . Poster . ... International Conference on Mathematical Modeling in Physical Sciences . ... International Conference on Mathematical Modeling in Physical Sciences, 2013, 1-5 September, Prague, Czech Republic . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>9) - lmmqsp.sinp.msu.ru/ )

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>37) - uhecr.sinp.msu.ru/ )

• Publications on Transient luminous events
• Lab's publications
• Publications UHECR

... RELEC Mission: Relativistic ELECtron Precipitation and TLE Study on-board Small Spacecraft . ... Spacecraft mass: 283 kg. ... The Program of RELEC workshop July, 28, 29, Moscow more details.. ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...

Еще в разделе: (Показать все результаты (>4) - dubrovinlab.msu.ru/ )

... В данном разделе приводятся публикации проекта по созданию семейства реконфигурируемых вычислительных систем в рамках государственного контракта N 02.524.12.4002 от 20 апреля 2007 г. федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы". ... Материалы Международной научной конференции "Параллельные вычислительные технологии" (ПаВТ 2008), г. Санкт-Петербург, 29 - 31 января 2008, Россия. ... Минск,...

Еще в разделе: (Показать все результаты (>2) - fpga.parallel.ru/ )

... THEORETICAL PRINCIPLES AND METHODS OF REMEDIATION OF SOILS POLLUTED WITH HEAVY METALS . Galina Koptsik . ... Development of current principles and approaches for soil remediation in heavy metal polluted areas. ... The project aims to study and develop, both theoretically and experimentally, the current approaches to remediation of soils polluted with heavy metals. ... Potentialities and constraints of different approaches for remediation of heavy metal polluted soils will be analysed. ...

Еще в разделе: (Показать все результаты (>14) - eco.soil.msu.ru/ )

• Polluting metals in Russian terrestrial ecosystems: chemistry, dynamics, and
• Risks of heavy metal inputs to agricultural and forest ecosystems in russia and

... Search for Single Top Quark Production at DZero using Neural Networks" . ... Search for Single Top Quark Production at D0 Using Neural Networks" . ... Search for Electroweak Production of Single Top Quarks" . ... Use of Neural Networks in a Search for Single Top Quark Production at D0", . ... Search for Single Top Quark Production at the Tevatron" . ... Use of Neural Networks in a Search for Single Top Quark Production with the DZero Detector at the Fermilab Tevatron Collider", . ...

Еще в разделе: (Показать все результаты (>6) - top.sinp.msu.ru/ )

• Lev V. Dudko Home Page

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )