Here is a list of previous events held by our Department. April 23, 2012 . Round Table Repeated Speech: Between a Commonplace and an Artistic Experiment held as a part of the Lomonosov Readings conference. ... Lecture Language, Culture and Hegemony: Rethinking the Politics of Culture in the єбє¬ntext of the Russian Revolution . ... Round Table . ... November 30, 2011 . ... Round Table Reading a Monument: A Memorial Place in the City (held as a part of the conference Polyphony of the City ). ...

Еще в разделе: (Показать все результаты (>11) - discours.philol.msu.ru/ )

• Publications
• Department
• Summer School 2016

Gamma-rays above 10 TeV Dieter Horns ­ University Hamburg RXJ1713-3946 [HESS Coll. ... The indirect path to the accelerator sky Dieter Horns ­ University Hamburg Is it a good deal? [astro-ph/0607109] Unveiling Cosmic Ray accelerators: Interstellar medium ( B-field + gas + photons) Accelerated Nuclei Meson production via inelastic scattering Gamma-rays , Neutrinos Cosmic rays Neutral particles (photons neutrinos) retain directional information: Accelerator sky Charged particles ( ...

Еще в разделе: (Показать все результаты (>6) - tunka.sinp.msu.ru/ )

... 4] Recently, we introduced orthometalated complexes of PdII and PtII as mimetics of metal-dependent esterases. ... 5] However, the rates of hydrolysis of amino acid esters were not very striking, although the catalysts had features typical of metallohydrolases.[5b] It could be argued that a square-planar metal configuration, which is not reported in enzymes, is less favorable for catalysis, and that PdII and PtII are Єsoftє acids which require Єsofterє bases for efficient catalysis. ... Chem. ...

Еще в разделе: (Показать все результаты (>156) - www.enzyme.chem.msu.ru/ )

• Recent reports on conferences
• B I O C A T A L Y S I S - 2007. Structure, functions, applications.
• Article

PHYSICAL REVIEW A 68, 022309 2003 Entangling quantum measurements and their properties B. A. Grishanin* and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, 119899 Moscow, Russia Received 20 December 2002; published 20 August 2003 We study the mathematical structure of superoperators describing quantum measurements, including the entangling measurement --the generalization of the standard quantum ...

Еще в разделе: (Показать все результаты (>96) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA-2000-61-52305-en.pdf
• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf
• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

astro-ph/0207074 . ... Comments: 42 pages, 10 figures, accepted for publication in the September issue of PASP . ... Commets: 5 pages, 4 figures. ... Commets: 4 pages, 3 figures, to appear in proceedings of the conference "Ra Pulsars" held in Chania, Crete, Sept 2002 . ... Commets: 6 pages, 2 postscript figures, to appear in the proceedings of the JENAM 2002 Workshop WS-VLTI "The Very Large Telescope Interferometer: Challenges for the Future", Editors: P.J.V. Garcia, A. Glindemann, Th. ...

Еще в разделе: (Показать все результаты (>455) - astro.uni-altai.ru/ )

• Новости науки
• Обзоры препринтов astro-ph

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>5) - www.law.msu.ru/ )

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, Department of the English Language Abstract Categorical Models of Quantum Mechanics By Alexander Zapryagaev, group 304 21 October 2014 The report deals with the axiomatic approach to the phenomena of quantum computation and algorithms. ... Finally, the logic behind quantum operations is discussed: it is revealed that the ideas of quantum algorithms have a strong connection to Jean-Yves Girard's linear logic. ...

Еще в разделе: (Показать все результаты (>25) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part2.pdf
• http://www.eng.math.msu.su/download/Podkolzina_TA_Test_Your_Knowledge_of_Great_Britain.pdf
• http://www.eng.math.msu.su/download/dictionary.pdf

Moscow State University Belozersky Institute of Physico-Chemical Biology . ... Snail-mail: A.N. Belozersky Institute of Physico-Chemical Biology Moscow State University, GSP-1, 119991 Moscow, Russia . ... Russia . 1993-1996 Post Graduate Student, A.N.Belozersky Institute of Physical and Chemical Biology, Moscow State University, Moscow, Russia . 1996-present Senior Researcher, A.N.Belozersky Institute of Physical and Chemical Biology, Moscow State University, Moscow, Russia. ...

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

... Институт . ... Студентам . Приветствуем вас на Официальном сайте Русско-германского института науки и культуры. Published by admin on April 6, 2016 under Новости . ... No Comments ? ... 09.00 - 15.30 љ љљ 736 - 1.ГУМ . ... Морозова Е.Б. пн. љ17-00? 18-30, 18-45?20-15, 20-30?21-15љ 1 к., ауд.736 1 ГУМ . ... Башкиров В. М. вторник 15.00-17.00, четверг љ15.00-17.00, 1 ГУМ ауд.736 . вторник 17.00-19.00, пятница 17.00-19.00 1 ГУМ ауд.736 . ... 736 1 Гум) . ... 7361 Гум) . ... December 2011 . ...

Еще в разделе: (Показать все результаты (>2) - rgi.msu.ru/ )

... В данном разделе приводятся публикации проекта по созданию семейства реконфигурируемых вычислительных систем в рамках государственного контракта N 02.524.12.4002 от 20 апреля 2007 г. федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы". ... Материалы Международной научной конференции "Параллельные вычислительные технологии" (ПаВТ 2008), г. Санкт-Петербург, 29 - 31 января 2008, Россия. ... Минск,...

Еще в разделе: (Показать все результаты (>2) - fpga.parallel.ru/ )

THE JOURNAL OF CHEMICAL PHYSICS 133, 144101 2010 Effective numbers of modes applied to analysis of internal dynamics of weakly bound clusters A. A. Rybakov,a E. D. Belega, and D. N. Trubnikov Department of ... Russia Received 11 June 2009; accepted 14 September 2010; published online 11 October 2010 The dependence of the volume of the chaotic component in the internal dynamics of triatomic van der Waals clusters on the angular ... When such difference is small, the regular motion disappears. ...

Еще в разделе: (Показать все результаты (>23) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/sotrudniki/larin/CC_EF1f.doc
• http://beams.chem.msu.ru/sotrudniki/larin/IJIM99.pdf
• http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf

Tuesday, September 28th, 2010 . 14-17 сентября 2010 года прошла международная конференция WEGENER (http://www NULL .koeri NULL .boun NULL .edu NULL .tr/jeodezi/wegener2010/) (Bogazici University, Istanbul / TURKEY), в которой мы приняли участие и сделали два доклада: . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for September, 2010. ... Публикации за 2011 . Публикации за 2012 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>38) - geo.sai.msu.ru/ )

• September 2013 Лаборатория лазерной интерферометрии

... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...

Еще в разделе: (Показать все результаты (>8) - rnp-group.genebee.msu.ru/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>3) - do.chem.msu.ru/ )

... 6:30 - 7:00pm |Transit to Executive Learning | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | ... 10:30 - 10:45am |Funds |Executive Dining Room | Claude Legrand |10:45am - 12:30pm|Refreshment Break |ELC x.206 | ... 10:30 - 10:45am |Refreshment Break |Executive Dining Room | ... Lunch |Executive Dining Room | ... 2:30 - 2:45pm |Refreshment Break |Executive Dining Room | ... 4:00 - 4:15pm |Refreshment Break |Executive Dining Room | ... 5:15 - 5:30pm |Refreshment Break |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

• http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Nov4-Nov12_2007.doc

... Smurova KM, Alieva IB, Vorob'ev IA. Free and centrosome-attached microtubules: quantitative analysis and themodeling of two-component system. ... Genes Cells. ... Mimori-Kiyosue Y, Grigoriev I, Lansbergen G, Sasaki H, Matsui C, Severin F, Galjart N, Grosveld F, Vorobjev I, Tsukita S, Akhmanova A. CLASP1 and CLASP2 bind to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J Cell Biol. ... Cell Biol Int. 2004;28(2):139-50. ... Membr Cell Biol. 1997;11(2):195-211. in Russian . ...

Еще в разделе: (Показать все результаты (>40) - cellmotility.genebee.msu.ru/ )

• publications2
• Cell Motility Lab

Автор: К.Роджерс . ... Есть много попыток определить понятие эмпатия , и мне самому принадлежит несколько. ... Быть в состоянии эмпатии означает воспринимать внутренний мир другого точно, с сохранением эмоциональных и смысловых оттенков. ... Суммируя кратко, Гендлин считает, что в любой момент времени человек испытывает состояния, к которым он может многократно обращаться в процессе поиска их смысла. ... Я больше не говорю состояние эмпатии , потому что думаю, что это скорее процесс, чем состояние. ...

Еще в разделе: (Показать все результаты (>243) - www.flogiston.ru/ )