THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The active sites on the surface of the nanocrystalline metal oxides and specificity of their interactions with nitrogen-containing organic compounds . ... Selected synthesis methods allow to control the composition and content of the resulting materials used modifiers (SiO 2 , Al 2 O 3 , Cr 2 O 3 , Nb 2 O 5 , Au). ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>20) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials |

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...

Еще в разделе: (Показать все результаты (>7) - ani.cs.msu.su/ )

• Учебные курсы ведущих университетов мира

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>13) - iconolat13.phys.msu.ru/ )

• Proceedings
• Visa to entry Russia
• Conference venue

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . ... Select Type . ... Ref . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Config.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>22) - osk.msu.ru/ )

• http://osk.msu.ru/forum/members/adollekautoto.2142/?_debug=1
• http://osk.msu.ru/forum/members/arbimeorirm.2192/?_debug=1
• http://osk.msu.ru/forum/members/catyfopwbex.2168/?_debug=1

... Egor V. Tikhonov Department of Chemistry Moscow State University Leninskie Gory Moscow, Russia,119992 Tel: (095) 939-2086 FAX: (095) 932-8846 e-mail: high_egor@mail.ru . ... Student, Diploma work 'Study of oxidation of PbTe surfaces' . ... Field of interest : surface science, solid state chemistry and physics, synchrotron radiation, semiconductors, crystal growth techniques. ... Тихонов Е.В. Определение лимитирующей стадии роста кристаллов PbSe методом 'пар-жидкость-кристалл'. ... Тихонов Е.В.. ...

Еще в разделе: (Показать все результаты (>27) - www.inorg.chem.msu.ru/ )

... The experimental study of magnetic ordering, magnetoelastic, magnetocaloric and galvanomagnetic effects, exchange and magnetocrystalline interactions in rare earth metals, alloys and compounds. ... the Divisions of chemistry and physics of high pressures of the chemical faculty MSU; . ... Tver' State University . ... The effect of rare earth sublattice on magnetic anisotropy in these compounds has been determined. The magnetic order in R(Fe,Co)(Si,Ge) compounds has been investigated. ...

Еще в разделе: (Показать все результаты (>13) - ferro.phys.msu.ru/ )

• Laboratory of Ferroelectricity
• Department of General Physics and magneto-ordered matter. Physics Department of

... О межфакультетских курсах МГУ . Видео МФК . ... Канал МГУ на YouTube . ... Комментарии Дата Просмотры Лайки Комментарии Упорядочить по возрастанию . ... x25BA; Кинофонд МГУ (95) . ... x25BA; Фильмы о МГУ (5) . ... x25BA; СУНЦ МГУ (5) . ... x25BA; МФК (1084) . ... x25BA; Механико-математический факультет (5) . ... x25BA; Социологический факультет (13) . ... x25BA; Факультет журналистики (11) . ... x25BA; Факультет наук о материалах (7) . ... Copyright 2016 © Видеоархив МГУ имени М.В.Ломоносова . ...

Еще в разделе: (Показать все результаты (>176) - media.msu.ru/ )

• Университетские субботы (МГУ-школе) | Видеоархив МГУ имени М.В.Ломоносова

... Not until everyone ... by the Customs Authorities were passengers allowed to enter the country. had searched . ... Were ... being robbed . ... Peter is not ... he seems. so self-confident like . ... The more you read in English, .... your command of the language will be better . will be better your command of the language . the better your command of the language will be . your better command of the language will be . ... The food is ... and it tastes .... quite expensive ... badly . ...

Еще в разделе: (Показать все результаты (>9) - anazarenko.ffl.msu.ru/ )

• Дистанционные курсы

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Moscow State University Belozersky Institute of Physico-Chemical Biology . The Department of Electron Microscopy offers positions in the area of molecular biology of the cell for excellent and highly motivated biologists at under-graduate or post-graduate level. Students : We are constantly offering diploma thesis and PhD thesis projects for students in cell biology and biophysics. The applicant is expected to have a strong interest in either experimental activity or computer modeling. ...

Еще в разделе: (Показать все результаты (>2) - cellbiol.genebee.msu.ru/ )

Главная Программы Doing Business in Russia . Study the Russian business with Lomonosov Moscow State University Business School . ... The objective of the program Doing Business in Russia is to make participants familiar with the instruments frameworks and cases which will allow them to understand the key driving factors of the Russian economy, business and its business culture. The participants will be introduced to the real-life success stories of the Russian and international companies. ...

Еще в разделе: (Показать все результаты (>112) - www.mgubs.ru/ )

• Преподаватель ВШБ Сергей Заверский выступил с докладом 'Spatial Distribution of
• Выпуск 1/2/2014 | Высшая школа бизнеса МГУ им. Ломоносова
• Вестник Московского университета | Высшая школа бизнеса МГУ им. Ломоносова

... sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial ARTICLE IN PRESS JOURNAL OF SOUND AND VIBRATION Journal of Sound and Vibration 298 (2006) 471 - 474 www.elsevier.com/locate/jsvi Short Communication Wolfhard Kliema, Alexei A. Mailybaevb,Г, Christian Pommer a copy Conditions revisited for asymptotic stability of pervasive damped linear ... In the case of an indefinite damping matrix, system (1) may be stable or unstable. ...

Еще в разделе: (Показать все результаты (>28) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/mailybaevseyranian2008.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev2000.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev2001.pdf

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• "Advanced Methods in Validation and Identification of Nonlinear Constitutive

Current Issue | Archive | About Journal | ... Open access to Archive of Journal's issues is available on the site (only for issues published over 12 months ago). Full-text versions of all issues of the Journal are available on elibrary.ru and on ebiblioteka.ru . Journal is distributed by subscription. Subscription index: 71500 (catalogue 'Rospechat') . ... To buy print version of the Journal please contact Moscow State University Press . ...

Еще в разделе: (Показать все результаты (>25) - www.socio.msu.ru/ )

• English version - Социологический факультет МГУ

... View Latest Revision . Revision Log Mode: Stop on copy Follow copies Show only adds and deletes View log starting at and back to . Show at most revisions per page. Show full log messages . Added . ... Log Message . ... Alex Martynov . fixed bag of unlimited run added screen . ... added new screen, restart now can operate at any moment . add) . ... added screens . Note: See TracRevisionLog for help on using the revision log. ...

Еще в разделе: (Показать все результаты (>53) - kodomo.cmm.msu.su/ )

• snakes (log) тАУ Python Battle

... Nonlinearoptical magnetic Kerr effect in MPC with a half-wavelength-thick Bi-substituted yttriumґironґgarnet layer sandwiched between two dielectric Bragg reflectors is studied in transversal, longitudinal, and polar configurations of the dc magnetic field application when the fundamental radiation is in the resonance with the allowed microcavity mode located in the photonic band gap. ... The SH intensity is enhanced as the fundamental wave is in resonance with the microcavity mode. ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>29) - shg.phys.msu.ru/ )

• http://shg.phys.msu.ru/ruscon/articles/pdf/02_JOSAB_19.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/96_PhysRevB_54.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/04_JETP98_THG.pdf

. Cайт превышает предел нагрузки на процессор . приобретенного тарифного плана хостинга. Попробуйте зайти позже. Site exceeds CPU load allowed by purchased hosting plan. Please try again later. Владельцу сайта: . описание ситуации на странице www.1gb.ru/autolimit .

Еще в разделе: (Показать все результаты (>10) - www.bukivedi.ru/ )

• www.99ru.ru - Aurifaber 1314

... All Authors Title Abstract Index terms Full Text . ... Home > ICONO/LAT 2016 > 2014 International Conference on Laser Applications in Life Sciences > About the Conference > Submissions . ... All URL addresses in the text (e.g., http://pkp.sfu.ca ) are activated and ready to click. ... If submitting to a peer-reviewed track of the conference, authors' names are removed from submission, with "Author" and year used in the bibliography and footnotes, instead of authors' name, paper title, etc. ...

Еще в разделе: (Показать все результаты (>23) - hea.phys.msu.su/ )

• About this Conference System

... Полная версия: Технические работы на сервере . Грация-МГУ::Форум > Общение > Другая жизнь . ... Apr 14 2011, 00:01 . ... сегодня весь день на сервере будут проводиться технические работы. ... Subject: Internet cleaning.....very important.. ... hours in order to allow us to clean it. ... Internet. ... Internet users has grown dramatically. ... to other sysops and Internet users as well. ... Internet users has grown dramatically. вопщем, очистка интырнетов это прекрастно во всех отношениях, ящитаю . ...

Еще в разделе: (Показать все результаты (>8) - grace.msu.ru/ )

• Технические работы на сервере - Грация-МГУ::Форум

Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...

Еще в разделе: (Показать все результаты (>65) - ffl.msu.ru/ )

• International Students
• Иностранным гражданам