NATIONAL ASSOCIATION OF APPLIED LINGUISTICS (RUSSIA) () - IV - « » ! IV « », 13 2013 - (. ). ­ ­ : - , ; - ( 7-10 ). . . . : : , . 15 2013 ( 4 ) ­ languages@inbox.ru 28 2013 . . : 1) (4 ) -- doc. (Word), Times New Roman, 16 , ; -- 1,25 .; ; 2 ; 2) .. -- 16 , , (, . .), ; 3) , -- 16 , , , (, . , - ); ; 4) -- 16 , , (, ); ; 5) : · ; · , , , ; · , , ; · ( /); · ; · , , . . . . . ( ) ­ 100 - 140410 . ., . , . 12, . 49 . !

Еще в разделе: (Показать все результаты (>3) - www.ffl.msu.ru/ )

... Contacts . ... The international academic grants (ERASMUS, Fox, Tempus). Participation in the international European associations (UNICA, EAU) . Send an e-mail to this Contact: . Enter your name: . E-mail address: . Message subject: . Enter your message: . Lomonosov Moscow State University . International Relations Office 2007-2008 ...

Еще в разделе: (Показать все результаты (>2) - www.ied.msu.ru/ )

... Работы в области фундаментальных наук, выполненные в сотрудничества с учеными ГАИШ МГУ, удостоены премии Киото . В Киото, Япония, были объявлены лауреаты 27-ой премии Киото (Kyoto Prize), учрежденной фондом Инамори (Inamori Foundation), сообщает Associated Press. ... Она вручается, начиная с 1985 года за достижения в 3 областях: в области высоких технологий, в области фундаментальных наук и в области философии и искусства. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>22) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ | Команда МГУ имени М.В. Ломоносова лидирует на
• MsuNews.Ru | Новости МГУ | За Фундаментальной библиотекой МГУ будет построено
• MsuNews.Ru | Новости МГУ | На факультете государственного управления МГУ

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>163) - www.pereplet.ru/ )

... Positions and Proper Motions of 258,997 Stars for the Epoch and |Equinox of 1950.0", Publ. of the Smithsonian Institution of |Washington, D.C., No. ... 1971-1979, "Lowell Proper Motion Survey" |(red dwarfs), Lowell Obs. ... LHS |Luyten, W. J. 1976, "A Catalog of Stars with Proper Motion |exceeding 0".5 annually", Publ. of Univ. of Minnesota, |Minneapolis, Minnesota; Luyten, W. J., Albers, H. 1979, "An |Atlas of Identification Chart for LHS Stars", Publ. of Univ. of |Minnesota, Minneapolis, Minnesota...

Еще в разделе: (Показать все результаты (>65) - sai.msu.ru/ )

• http://www.sai.msu.ru/groups/cluster/gcvs/gcvs/vol1/vol1.pdf
• http://www.sai.msu.ru/groups/cluster/gcvs/gcvs/iii/ref_abbr.txt
• А С Т Р О К У Р Ь Е Р

... 2016 . ... CEEISA-ISA 2016 Joint International Conference, Ljubljana . Co-joint Convention of the Central and East European International Studies Association (CEEISA) and the International Studies Association (ISA) The Politics of International Relations . Convention Section Communication management and international security . About the section . Section coordinators: . ... E-mail: iscpsc@mail.ru . ... E-mail: greg.simons@ucrs.uu.se . Section Secretary: . ...

Еще в разделе: (Показать все результаты (>11) - e-journal.spa.msu.ru/ )

... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ... ФГУ МГУ 2016 . ...

Еще в разделе: (Показать все результаты (>32) - www.spa.msu.ru/ )

• Сотрудники факультета госуправления

RIDGE AND TREE FEATURE DETECTION ON IMAGES A. Levashov 2, D. Yurin3 2, 3 1 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia 2 alexeylevashov89@gmail.com , 3yurin@cs.msu.ru In this article a new ridge detector with improved non-maxima suppression procedure in scale-space is proposed. ... The algorithm is tested on synthetic, landscape and medical images. ...

Еще в разделе: (Показать все результаты (>8) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf
• http://imaging.cs.msu.su/~yurin/Doxyfile

... BMC Genomics 2013, 14:745 http://www.biomedcentral.com/1471-2164/14/745 DATABASE Open Access RegPrecise 3.0 ­ A resource for genome-scale exploration of transcriptional regulation in bacteria Pavel S Novichkov1*, Alexey E Kazakov1, Dmitry A Ravcheev2,3, Semen A Leyn2, Galina Y Kovaleva1,2, Roman ... Inna Dubchak1 and Dmitry A Rodionov 2,3* Abstract Background: Genome-scale prediction of gene regulation and reconstruction of transcriptional ... Figure 5 The regulog page in RegPrecise. ...

Еще в разделе: (Показать все результаты (>9) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf

Higher-order anisotropic flows and dihadron correlations in Pb-Pb in AMPT" Jun Xu and Che Ming Ko Phys.Rev. C84 (2011) 044907, arXiv 1108.0717 .. ... Description of High harmonics and Ridge effect in AMPT. 2Part and Flow correlation 4. <uQ*> Some useful formulae, I Some useful formulae, II Some useful formulae, III Some useful formulae, IV Results, A. Anisotropic flows, centrality AMPT 1. ... B. Dihadron correlations, ||and pT Jet region Ridge region trigg 1. ... B. Dihadron correlations, || ...

Еще в разделе: (Показать все результаты (>37) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/report01_wl.ps
• http://lav01.sinp.msu.ru/~vlk/3pi0.ps
• http://lav01.sinp.msu.ru/nir/papers/NIM_3000-LGD.pdf

... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......

Еще в разделе: (Показать все результаты (>32) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3404.pdf
• http://library.biophys.msu.ru/PDF/3347.pdf
• http://mgumus.chem.msu.ru/publication/2006/perminova-mediating.pdf

... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...

Еще в разделе: (Показать все результаты (>3) - depository.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>27) - mailybaev.imec.msu.ru/ )

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

... Throughout the pap er by a four-valent graph we mean the following generalization: a finite 1-complex with each connected comp onent b eing homeomorphic either to a circle or to a four-valent graph; by a vertex of a four-valent graph we mean only vertices of those comp onents which are homeomorphic to four-valent graphs, and by edges we mean b oth edges of four-valent graphs and circular comp onents (the latter will b e called cyclic edges). ... A free knot is a 1-comp onent free link. ...

Еще в разделе: (Показать все результаты (>20) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/papers-sym/0503389v1.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

THE FIRST JAPAN-RUSSIA MEDICAL FORUM PROGRAM Date: December 10, 2012 Venue : Intellectual Center - Fundamental Library of Lomonosov Moscow State University Bld.27, Lomonosovskiy prospect, Moscow , 119991, Russia Organizers: Lomonosov Moscow State University Tohoku University Supported by Embassy of ...

Еще в разделе: (Показать все результаты (>6) - fbm.msu.ru/ )

• Факультет фундаментальной медицины МГУ

... The detectors used in the setup had efficiency three orders of magnitude better than ones used before. ... As a result, effect of nonlocal influences of several largescale processes related with the weather changes, the geomagnetic variations, the ionospheric and solar activity have reliable been detected. ... йи з ед гв б 7 (2) (3) (4) All known local factors influencing on : temperature, pressure, chemism, illumination, electric field etc. must be excluded or stabilised. ...

Еще в разделе: (Показать все результаты (>5) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/korotaev_geophysical.pdf

... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...

Еще в разделе: (Показать все результаты (>8) - lcc.chem.msu.ru/ )

• Research Interests

... Preferences . ... Date & Time . ... Time zone: Default time zone Africa/Abidjan Africa/Accra Africa/Addis_Ababa Africa/Algiers Africa/Asmara Africa/Bamako Africa/Bangui Africa/Banjul Africa ... Africa/Niamey Africa/Nouakchott Africa/Ouagadougou Africa/Porto-Novo Africa/Sao_Tome Africa/Tripoli Africa/Tunis Africa/Windhoek America /Adak America /Anchorage America /Anguilla America /Antigua America /Araguaina America /Argentina/Buenos_Aires America /Argentina/Catamarca ...

Еще в разделе: (Показать все результаты (>4) - kodomo.cmm.msu.su/ )

• Preferences: Date & Time тАУ Petri Dish
• Preferences: Date & Time тАУ Python Battle
• Preferences: Date & Time тАУ Tanchiki