Curriculum Vitae of Dr Alexei A. Mailybaev . ... A.P. Seyranian and A.A. Mailybaev, Multiparameter Stability Theory with Mechanical Applications , World Scientific, New Jersey, 2004. ... A.A. Mailybaev and A.P. Seyranian, Bifurcations of equilibria in potential systems at bimodal critical points, Journal of Applied Mechanics 75 (2008), 021016. ... A.P. Seyranian and A.A. Mailybaev, On stability boundaries of conservative systems, Journal of Applied Mathematics and Physics (ZAMP) 52 (2001), 669-679. ...
... solvation nucleation of the polymorphs Solute-solute interactions, association parameters , thermodynamics parameters , conformations growth of the crystal Nature of solvent, intermolecular interactions (solute solvent, solute-solute), conformations Lattice energy , entropy of the crystal, symmetry of the lattice, conformations The conformational manifolds is the candidate to be a coordinate of reaction Methods of investigations Quantum chemistry ...
... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the proteinprotein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...
... Professional experience . ... Department of Geology. Chair of Dynamic Geology. ... Laboratory of Geodynamic Processes Modeling. ... 2001 Elaboration (together with V.Vadkovsky ) electronic version of textbook on course "Dynamic Processes in Geology" for students of 5th course and postgraduate students (MSU. ... 2000 - Delivering lectures and performing exercises with students on the course "Computer Simulation Of Geodynamic Processes" for students of 3rd course (MSU. ... Page design: їV.Zakharov . ...
... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...
... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... О кафедре . ... Главная Наши сотрудники Голубцов Петр Викторович . ... 2 г. Москвы поступил на физический факультет МГУ им. М. В. Ломоносова. По окончании физического факультета в 1983 году поступил на работу на кафедру математики. ... С 2001 года П. В. Голубцов работает на кафедре математики в должности профессора. ... В 1995 году П.В. Голубцов был отмечен премией конкурса молодых преподавателей физического факультета МГУ. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...
... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...
... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....
Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...
... Web Extension to American Psychological Association Style (WEAPAS) (Rev. 1.4.3) [WWW document]. URL http://www.beadsland.com/weapas/ . Этот документ содержит дополнения к Приложению 3-A (Appendix 3-A, APA, 1994 , pp. 189-222) и использует стандарт Интернет касающийся унифицированных локаторов ресурсов (URL) ( Graham, 1995 ), используемый на World Wide Web (WWW или Web) ( W3C, 1995 ). ... Желающие использовать библиографический стиль MLA могут обратиться к Walker ( 1995 ) и Wainwright ( 1995 ). ...
Сотрудниками лаборатории было написано несколько книг по теории атомного ядра, некоторые представлены на данной странице: . ... Nuclear Physics A , изд - во Elsevier BV (Netherlands) 2015, . ... International Workshop on Strangeness Nuclear Physics, July 29-31, 2004, Osaka, Japan, 1 сотрудник , 1 доклад . ... XVII International Baldin seminar on high energy physics problems 'Relativistic nuclear physics and quantum chromodynamics', September 27- October 2, 2004, Дубна , 1 сотрудник , 1 доклад . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...