Лекция В.Н. Робука из цикла "Дифференциальные уравнения", 01.06.15, ЛТФ ОИЯИ . В этот понедельник, 1-го июня, состоится очередная лекция В.Н. Робука, посвященная симметрии систем линейных дифференциальных уравнений: . Дискриминанты алгебраических уравнений и минимальный полином для присоединенного представления матричной алгебры Ли. ... Начало в 17.30, аудитория DIAS-HALL, ЛТФ. Начало цикла лекций: http://www.msu.dubna.ru/main/index.php?id=95&Itemid=30&option=com_content&task=view ...
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... We present the simulation framework CRPropa version 3 designed for efficient development of astrophysical predictions for ultra-high energy particles. Users can assemble modules of the most relevant propagation effects in galactic and extragalactic space, include their own physics modules with new features, and receive on output primary and secondary cosmic messengers including nuclei, neutrinos and photons. ...
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
. Московский государственный Университет . им. М.В.Ломоносова . Главная страница . Уставные документы . Об истории физического факультета . Литературная страница . База данных выпускников . Курсовые страницы . Уточнить информацию о выпускнике . 50 лет ССО . Объявления Совета выпусков . Наши реквизиты . Образцы документов . Наши ссылки . Социальная сеть Союза Выпускников . Оформление Гусаковой Д.Ю. , Web-программирование Тарасов А.Б. Тел. Союза выпускников 939-32-84 Administrator
Кафедра биофизики . ... Kovalenko I. B. , Abaturova A. M. , Diakonova A. N. , Ustinin D. M. , Grachev E. A. , Rubin A. B. New direct dynamic models of protein interactions coupled to photosynthetic electron transport reactions // Biophys. ... Коваленко И. Б. , Абатурова А. М. , Громов П. А. , Устинин Д. М. , Грачев Н. Е. , Ризниченко Г. Ю. , Рубин А. Б. Компьютерное моделирование образования комплекса между пластоцианином и цитохромом f в люмене тилакоида Биофизика, 2008, 53 (2) 261-270 . ...
... Новости . ... О кафедре . ... Занятия в среду 7.11.2012 по Современным компьютерным технологиям (преподаватель Краев А.В.) на первой паре не состоится и переносится в связи с календарным отпуском преподавателя. ... Автор: Краев Андрей Владимирович 06.11.2012 . ... Будут заслушены доклады Аристова А.И., Карамышевой Т.В., Краева А.В., Будановой А.В. Автор: Фурсов Андрей Серафимович 27.10.2012 . ... Colin Angle - основателя и руководителя компании iRobot, крупного специалиста в области робототехники. ...
... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...
... investigation of interactions between soil and atmospheric pollutants - sulphur and heavy metals (nickel and copper). ... Evaluation of sulphur and heavy metal deposition effects on forest soils near a large pollution source. ... Forest soil response to acid deposition, in particular the significance of soil organic matter in the processes of proton consumption, sulphur retention, aluminum and heavy metals mobilization was investigated. ... Acid Deposition and Forest Soils. ... Soil Science Faculty ...
... www.net.cmu.edu (Carnegie Mellon University, Pittsburgh, PA - English) - D . ... Washington, DC - English) - A* This site is a general network-troubleshooting utility; it runs BGP, ping, traceroute, and a number of other routing-related utilities. ... www.efrei.fr (Efrei's, Paris - French) - * Options for timeout, TTL, name resolution . ... English) . ... Each one has a link to a network information tool, which will do an nslookup, visual ping, 30-packet ping, or traceroute to it. ...
Lomonosov Moscow State University | pic] |Faculty of Biology | ... Application | ... Name | ... First Name | ... Other Names | ... Date of Birth | ... Place of Birth | ... Passport | ... Passport issued | ... City | ... 2.|e-mail | ... Faculty | ... Russian Consulate to be applied to for visa[1] |10.| City, state | ... The visa invitation supposes your stay in Moscow and a region adjacent to WSBS ONLY. ... 1] Cannot be changed after application ...
LOMONOSOV MOSCOW STATE UNIVERSITY Faculty of Journalism RUSSIAN MEDIA and JOURNALISM International Programme Application Personal Details: ( please write clearly using capital letters) First name : Family name : Date of Birth (dd /mm /yyyy ): Gender: Nationality: Occupation: If you are currently a student, please write the name of your home institution: Current home The Faculty needs at least 45 days before your arrival to Russia to issue your visa invitation. ...
[
Текст
]
Ссылки http://www.journ.msu.ru/eng/admissions/application-russian-media.doc -- 70.5 Кб -- 05.10.2010 Похожие документы
ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы