... 2 dne 2 = i ne + ( D ne ) - r ne . ... bi , ( ) bi : (7) bi вp = Const [ 2 / ] . ... Ti = Tg. : dTe = - eg (Te - Tg ) , dt k bi (Te + Ti ) , e (6) (8) 3 eg - , - , . eg , (8) : t Te (t ) - Tg = (Te (0) - Tg ) exp (- ) , (9) Te(0) - ( ), = 1 - eg , = 2me / M , = M 2me eg , me - . ... 10 i = 4,1в106вpвexp( - eIi / kTe )в( kTe /e ) 0,5 вIi , ( 1 / ) ( 23 ) p - , Ii - , Ii = 24,5 , kTe / e - . ... LEFT», «RIGHT») , . ENTER» , , , .. ESC» ­ 1 . ... ln (Net/Ne0)» « (1/N)» « » «» - . ...

Еще в разделе: (Показать все результаты (>3) - physelec.phys.msu.ru/ )

... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...

Еще в разделе: (Показать все результаты (>4) - www.students.chemport.ru/ )

... Happy Russian's day! Recently a new project was entered in a list of projects of State Duma.It is on celebrating a new state holiday - the Russian's day. (more.. 03.12.2003 . The Swedish literature prize for the Russian literature. ... Welcome to Switzerland!! ... In the very end of November it was birthday of the letter Е and the teachers and students of the Russian language centre celebrated it. ... Russian proverbs and sayings about Russian language: . ...

Еще в разделе: (Показать все результаты (>3) - www.rlcentre.com/ )

• "ABOUT RUSSIAN" - журнал о русских людях и их языке

... 2-4 классы . ... МАЛЫЙ МЕХМАТ - ШКОЛЕ . ... 5 класс: набор состоялся 13 февраля . Следующий набор пока не планируется. 6 класс: набор состоялся 27 февраля. Следующий набор пока не планируется. 7 класс: следующий набор состоится 12 марта (открыта запись в лист ожидания). 8 класс: набор состоялся 13 февраля. Следующий набор пока не планируется. 1 4 классы (кружки Засыпкиной, Коробицына и Подгайц): набор закрыт. ... Обновлено по результатам наборов 14 ноября и 27 февраля. 7 класса (рук. ...

Еще в разделе: (Показать все результаты (>1282) - mmmf.msu.ru/ )

• Расписание | Малый мехмат МГУ

... 5) Two variant of calculation: Main 1 (absence of SNRs in the Earth vicinity with Emax =4 PeV ) and Main 2 (where 4 SNRs accelerate to 4 PeV ) give more or less similar structures around the knee Here we need to know MetaGalactic Sum Gal+Metag 025 0.20 · 10 7 · F(E) E 10 6 P He 3 .0 Fe · 10 5 C,O Si Pure Galactic · 10 4 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 E, GeV Contribution of nearby actual sources 10 1 Main 2 all p he cno si fe nearby ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

• Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>5) - edas2.bioinf.fbb.msu.ru/ )

• Elementary alternative
• Overall gene expression
• EDAS (human) - Alternative Splicing DataBase.

... research | ... Vladimir Alexeevich Kholodov . ... Dokuchaev Institute of Soil Science of Russian Academy of Agricultural Sciences, Moscow, Russia. ... Study at the Soil Science Department of Lomonosov Moscow State University. The diploma work "Toxicity of herbicides in soils of different types" was succesfully defended at the Chair of Agriculture, Soil Science Department. ... Post graduate student at the Division of Agriculture, Department of Soil Science, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>120) - mgumus.chem.msu.ru/ )

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>8) - textbook.sinp.msu.ru/ )

• Index of /modules/ax_visitors/atomax

... Study of diaries and notebooks . The project is devoted to the research work of diary texts in Russian tradition and worldwide. The task of the work is to study, describe and create an independent corpus of computerized diary texts, i.e. diaries, note-books, autobiographies, memoirs, letters, which are called 'everyday literature' or 'ego-texts'. ... It is necessary to classify all types of Russian diary texts dating at least from the 17th century and up to now. ...

Еще в разделе: (Показать все результаты (>20) - lcl.srcc.msu.ru/ )

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>12) - photonicslab.phys.msu.ru/ )

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>4) - margaret.imec.msu.ru/ )

• A Little History
• On Square Parachute Differential Equations

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

ORF ALEA CENTER FOR GL OB AL INTERNA TIONAL S TUDIES UNIVERSIT Y OF C ALIFORNIA, SANT A BARBAR A THE ROLE OF RELIGION IN GLOBAL CIVIL SOCIETY: THE MOSCOW WORKSHOP Lomonosov Moscow State University Moscow , Russia June 19, 2013 Sponsored by the Henry R. Luce Initiative on Religion and International Affairs Luce Moscow Workshop The Moscow workshop for the Or falea Center 's Luce Project on religion in ... Moscow State University has its own church of the Saint Tatiana. ...

Еще в разделе: (Показать все результаты (>98) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf

... Changed pages: posts/seminar-24.03.2016 . Changed by: alexeybrazhe . Commit type: git . ... Changed pages: posts/seminar-03.12.2015 . ... Changed pages: posts/seminar-25.12.2014 . ... Changed pages: posts/seminar-03.03.2015 posts/seminar-10.03.2015 . ... Changed pages: local.css posts/seminar-03.03.2015 . ... Changed pages: local.css posts/seminar-24.09.2013 . ... Changed pages: local.css media/files/seminar-24.09.2013.2.png media/files/Киселева автореферат.doc posts/seminar-24.09.2013 . ...

Еще в разделе: (Показать все результаты (>4) - cell.biophys.msu.ru/ )