МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
... В Высшей школе государственного аудита прошла Неделя Карьеры ?ТВОЙ СТАРТ!? ... Визит делегации Высшей школы государственного аудита МГУ в Нанкинский Университет Аудита (Китай) . ... В мероприятии приняли участие студенты и аспиранты из Высшей школы государственного аудита МГУ , Финансового университета при Правительстве Российской Федерации, Российского экономического университета имени Г.В. Плеханова, Московского университета МВД России имени В.Я. Кикотя, Академии управления МВД [ ] . ...
... Mathematical Theory of Feedback Control . ... Annotation: this course is about mathematical equations of atmospheric diffusion which allow modeling of the problems of environment. ... The course reflects the experience and the point of view of a research group in the field of mathematical modeling of Western, Soviet and later Russian economics. ... Such approach captures the behavior of rather complex systems. ... Scientific Seminar: Mathematical Modeling of Complex Systems . ...
479 (2012) 183-185 Contents lists available at SciVerse ScienceDirect Physica C journal h omepage: www.else vier.com/locate/physc Near-field optical microscopy of plasmonic effects in anisotropic metamaterials M.R. Shcherbakov a,, B.B. Tsema a b c a,b , Yu.B. Tsema a, A.A. Ezhov a, V.I. Panov a, D.P Absolute measurements of near-field linear dichroism are performed for an array of plasmonic nanowires by measuring the linear dichroism value at the edge of the sample. ... 1о? aei/ ?b0 sin h ? ...
[
Текст
]
Ссылки http://nanolab.phys.msu.ru/sites/default/files/physc479_183_2012.pdf -- 257.5 Кб -- 16.05.2013 Похожие документы
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... Nikolaev V.K., Leontovich A.M., Drachev V.A., Brodsky L.I. Building multiple alignment using iterative analyzing biopolymers structure dynamic improvement of the initial motif alignment, 1997, Biochemistry, 62,6,578-582. ... Multiple Sequence Alignment is the arrangement of several protein or nucleic acid sequences with postulated gaps so that similar residues (in one-letter code) are juxtaposed. ... construction of pairwise MOTIFS . ... POWER . ... to create all pair motifs ("Sequence-sequence"); ....
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...
... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...
... Заведующий лаборатории - профессор А.В. Немухин . ... IV Международный симпозиум "Topical Problems of Biophotonics", 21-27 июля , Нижний Новгород Приглашенный доклад: М.Г. Хренова , А.В. Немухин, А.П. Савицкий "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ... Конференция Biocatalysis-2013, 2-7 июля Москва Доклад: А.В. Немухин "Molecular mechanisms of the enzymatic hydrolysis reactions of nucleotide triphosphates" . ...
Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...
... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...
... Davis Center for Russian Studies at Harvard University. The Center aims at developing of fundamental knowledge about Russia, its culture, and its institutions. The Center also examines Russia in its regional and historical context, and welcomes and supports the study of neighboring countries that have been either integrated with, or subordinated to, the Russian state at various periods in history, or whose experience poses intellectual problems similar to those of Russia. ...
... Department of Vertebrate Zoology . Department of Vertebrate Zoology is one of the oldest departments of the Biological Faculty of Lomonosov Moscow State University. ... The students improve their practical skills in the courses of Microtechniques, Computer Methods in Biology and Methods of Field Research. ... The Department includes five research laboratories. ... Laboratory of Vertebrate Behaviour conducts research on the development of behavioural interactions in the higher vertebrates. ...
... Кафедра . ... Заведующий кафедрой . ... Lecture courseљfor postgraduate students (General Linguistics Department) . ... Sociolinguistics is the study of language in relation to society, linguistic behavior in any community. ... May language be a social marker of separate identity? How do individuals and social groups define themselves in and through language? How is language involved in social conflicts and tensions? ... Ignoring the fundamentally social and behavioral nature of language . ...