... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Posted in: News . Sorry, this entry is only available in Русский . ... Older Entries . ...

Еще в разделе: (Показать все результаты (>6) - new.choir.msu.ru/ )

... Phosphorylation of more than one site is required for tight interaction of human tau protein with 14-3-3zeta. ... Serine residues phosphorylated by protein kinase A (PKA) in the shortest isoform of human tau protein (tau3) were sequentially replaced by alanine and interaction of phosphorylated tau3 and its mutants with 14-3-3 was investigated. ... Thus, two sites located in the Pro-rich region and in the pseudo repeats of tau3 are involved in phosphorylation-dependent interaction of tau3 with 14-3-3...

Еще в разделе: (Показать все результаты (>60) - biochem.bio.msu.ru/ )

• Biochemistry Department of Moscow State University | The physiological role of
• Energy-linked binding of Pi is required for continuous steady-state
• Sulfated and sulfonated polymers are able to solubilize efficiently the protein

General Information . ... Local Information . ... The city represents great cultural value because in the late 19th and early 20th centuries, Kislovodsk as a fashionable spa attracted many musicians, artists, and members of the Russian aristocracy. ... Double room with full pension (breakfast, lunch, dinner) - 2620 rubles per person per night. solnechniy . ... Citizens of most countries need visa to enter the Russian Federation. ... Victor Kornilov, Sternberg Astronomical Institute (chair) . ...

Еще в разделе: (Показать все результаты (>19) - site2010.sai.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... About hotel . Services . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! Feel free to share your opinion about us .. Hotel "69 Parallel" offers its guests meeting room for meetings, seminars and presentations. ... The cost of the lease without the use of equipment is 200 rubles for one hour. ... Order: (8152) 253-700, reserv@69parallel.ru . ... The hotel "69 Parallel" gives you the following list of services: . ...

Еще в разделе: (Показать все результаты (>11) - 69parallel.ru/ )

RUSSIAN version . ... Sergei V. OGURTSOV . ... In 2002-2009 worked as a research scientist in the Department of Vertebrate Zoology of the Faculty of Biology MSU. Ph.D thesis entitled 'Learning the native pond odour as one of the mechanisms of chemosensory orientation of anuran amphibians' at Faculty of Biology MSU in 2004. ... Ogurtsov S.V., 2004. Olfactory orientation in anuran amphibians // Russian Journal of Herpetology, V. 11, ?1, p. 35-40. [download pdf-file] . Ogurtsov S.V., 2005. ...

Еще в разделе: (Показать все результаты (>45) - vertebrata.bio.msu.ru/ )

• Department of Vertebrate Zoology
• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...

Еще в разделе: (Показать все результаты (>11384) - conf.msu.ru/ )

Conference . ... 3rd Announcement . 2nd Announcement . ... The 2006 autumn IVOA Interoperability Meeting and Small Project Meeting will be held in Moscow, Russia, from September 18-22. The venue for the meeting are Institute of Astronomy, Sternberg Astronomical Institute and Headquarter of the Russian Academy of Sciences. ... Working Groups: VOTable, UCDs, Registry, Data Models, Data Access Layer, VO Query Language, Grid and Web Services, and VOEvent. Interest Groups: Applications, Theory. ...

249. Факультет иностранных языков и регионоведения МГУ. Центр дистанционного

250. http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/palaic1.pdf

251. http://uzmu.phys.msu.ru/issue/120101.pdf

252. Index of /~basrav/supercomp2010

253. Login required - MediaWiki

254. Olympiad

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда