Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Западная пивная компания приглашает на работу на должность System Network Administrator. ... Опыт работы от двух лет. ... Опыт работы с сетевым оборудованием Cisco. ... Западная пивная компания приглашает на работу на должность SAP Basis/DB2 Administrator. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ... Комментарии и предложения присылайте на адрес info@cmc online.ru . ...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
... О кафедре . ... Завершился курс "Методы лабораторных зоологических исследований", впервые проводимый в этом году. ... 11-й Морской семинар! Продолжить чтение . 31 марта 2016 (четверг), 13:00, 594 ауд. - заседание кафедры . ... Десятый семинар центра морских исследований МГУ . ... Девятый семинар центра морских исследований МГУ . ... JavaScript must be enabled in order for you to use Google Maps. However, it seems JavaScript is either disabled or not supported by your browser. ...
... The detectors used in the setup had efficiency three orders of magnitude better than ones used before. ... As a result, effect of nonlocal influences of several largescale processes related with the weather changes, the geomagnetic variations, the ionospheric and solar activity have reliable been detected. ... йи з ед гв б 7 (2) (3) (4) All known local factors influencing on : temperature, pressure, chemism, illumination, electric field etc. must be excluded or stabilised. ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/korotaev_experimental.pdf -- 224.4 Кб -- 27.02.2014 Похожие документы
МГУ имени М.В.Ломоносова Русская версия . ... Public and Municipal Administration . ... Public Relations and Theory of Communication . ... The section "Public Relations and Theory of Communication" based on an educational program "Advertisement and public relations" of Philosophical Faculty of MSU. The research supervisor of an educational program the head of "Philosophy of Language and Communication" department Kostikova A.A., the associate professor , candidate of philosophical sciences. ...
... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...
... Ph.D. in Physics and Mathematics (Theoretical and Computational Chemistry), Department of Chemistry, M.V.Lomonosov Moscow State University . M. Sc. in Chemistry, Department of Chemistry, M. V. Lomonosov Moscow State University (2000), Thesis: "Ab initio study of equilibrium structures and vibrational spectra of molecular clusters". ... Undergraduate Student, Department of Chemistry, M. V. Lomonosov Moscow State University (1995-2000). ... Quantum and Computational Chemistry; . ... autumn 2001. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Individual SELEX products, aptamers, are small molecules (40100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf -- 375.6 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/molbio2000.pdf -- 375.6 Кб -- 18.02.2008 Похожие документы
О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
... All rights reserved 0301-5629/98/$see front matter PII S0301-5629(98)00110-0 Original Contribution SHEAR WAVE ELASTICITY IMAGING : A NEW ULTRASONIC TECHNOLOGY OF MEDICAL DIAGNOSTICS A RMEN P. SARVAZYAN,* OLEG V. RUDENKO, SCOTT D. SWANSON, J. BRIAN F and STANISLAV ... Engineering Department, University of Michigan, Ann Arbor, MI (Received 5 September 1997; in final form 2 July 1998) Abstract-- Shear wave elasticity imaging ( ... Schematic presentation of shear wave elasticity imaging....
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/rudenko_files/98sweisarv.pdf -- 718.4 Кб -- 12.10.2007
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/rudenko_files/98sweisarv.pdf -- 718.4 Кб -- 12.10.2007 Похожие документы
ЖУРНАЛ МОСКОВСКОЙ ПАТРИАРХИИ . 12-2000 . ... OFFICIAL INFORMATION His Holiness Alexy II, Patriarch of Moscow and All Russia . ... Christmas Message to the Archpastors, Pastors, Monastics and All Faithful Children of the Russian Orthodox Church // 1 || ... 2000 Oration of His Holiness Patriarch Alexy of Moscow and All Russia after the Divine Liturgy in the Cathedral of the Dormition in the Moscow Kremlin at the Day of Opening of the Jubilee Bishops' Council of the Russian Orthodox Church // 9 || ...
... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
НЕЙРОСЕТЕВЫЕ МЕХАНИЗМЫ КОГНИТИВНОЙ ГИБКОСТИ А.Т. Терехин, Е.В. Будилова, М.П. Карпенко, Л.М. Качалова, Е.В. Чмыхова 1. ... Когнитивная гибкость нейронной сети определяется как актуальный диапазон изменения гладкости ее функции Ляпунова - большая гладкость облегчает нахождение стратегически эффективных направлений решения задачи, а меньшая необходима для проработки его деталей. ... При неизменных синаптических весах увеличение параметра гладкости приводит к увеличению гладкости функции энергии сети. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Rostov_Varifoc.doc -- 2025.0 Кб -- 09.06.2009 Похожие документы
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы