... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>23) - www.sai.msu.ru/ )

• Absolute proper motions of open clusters

... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...

Еще в разделе: (Показать все результаты (>6) - www.students.chemport.ru/ )

• тест ?1
• тест ?2 по английскому языку

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>5) - pk.math.msu.ru/ )

• Mechmath admission for internetional students

... The notion of convergence to zero in a vector space allows one to define convergence to any p oint by using a translation. ... The notion of a converging sequence can b e introduced without any top ology, by the definition of all sequences converging to some p oint. ... 1, then the sequence n xn converges to zero. ... In the case of the Euclidean top ology, where for at least one comp onent the inequality ci > 1/4 holds, the set J (f ) coincides with the whole space and hence the Julia set is empty....

Еще в разделе: (Показать все результаты (>34) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-185-2.pdf

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

Еще в разделе: (Показать все результаты (>2) - genseq.fbb.msu.ru/ )

... Carbamide . ... Moscow ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics  was established by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>5) - td.chem.msu.ru/ )

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

NEW ECONOMIC SCHOOL .. BSP/2007/094 R 2007 " " .. ... On The Dynamics of People's Unions / Working Paper # BSP/2007/094 R. - Moscow, New Economic School, 2007. - 19 p. (Rus.) ... Key words: public economics, allocation theory, size of nations ISBN © .. ... x[0,1] - (FOC) FOC: (W1 (x) + W2 (1 - x)) = 0, x (1) - (SOC) SOC: 2 (W1 (x) + W2 (1 - x)) 0. x2 (2) , (1) (2), .. ... Grossman & Mendoza, 2001, 2004) , , , : , . ... On the Number and Size of Nations", Quarterly Journal of Economics Vol. ...

Еще в разделе: (Показать все результаты (>9) - belyakov.imec.msu.ru/ )

Twilight observations with MASS/DIMM B. Safonov Sternberg Astronomical Institute Moscow State University Comprehensive Characterization of Astronomical Sites, 2010 B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 1 / 17 Why observe in twilight with MASS/DIMM? ... ASM includes 3 devices sensitive to background: guider, DIMM and MASS. B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 2 / 17 Background in guider. ...

Еще в разделе: (Показать все результаты (>11) - site2010.sai.msu.ru/ )

• General information

DAYS on DIFFRACTION' 2011 77 Analytical solutions for diffraction problem of nonlinear acoustic wave b eam in the stratified atmosphere Vladimir A. Gusev, Ruslan A. Zhostkow Department of Acoustics, Physical Faculty, Lomonosov's Moscow State University, Russia; e-mail: vgusev@bk.ru The nonlinear wave equation and mo dified KhokhlovґZab olotskaya typ e equation for high intensive acoustics wave b eams propagating in stratified atmosphere with inhomogeneous of sound sp eed is set up. ...

Еще в разделе: (Показать все результаты (>41) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/embed08.pdf
• http://acoustics.phys.msu.su/teachers/rudenko_files/98sweisarv.pdf

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

... Ultrastructural changes in the cell center during enterocyte differentiation in the mouse. Tsitologiia. ... Microtubule and intermediate filament patterns around the centrosome in interphase cells. ... The effect of the UV microirradiation of the centrosome on cell behavior. ... A stereoscopic analysis of the centrosome structure in tissue culture cells under the action of carbonyl cyanide p-trifluoromethoxyphenylhydrazone and ouabain Tsitologiia. ... Alieva IB, Vorob'ev IA, Chentsov YuS. ...

Еще в разделе: (Показать все результаты (>35) - cellmotility.genebee.msu.ru/ )

... Если в сложно-составных предложениях (т.е. в предложениях, состоящих из нескольких независимых предложений) независимые предложения разделяются сочинительными союзами ( and, but, or, nor, for, yet, so, as (в смысле since, because ), while (в смысле at the same time )), то перед этими союзами ставятся запятые: . ... He could go into debt for the sports car, or he could buy the much cheaper economy car . ... Запятая также может быть опущена, если одно из двух независимых предложений "короткое". ...

Еще в разделе: (Показать все результаты (>29) - num-anal.srcc.msu.ru/ )

... Doronina L. , Volodin I., Volodina E. The arousal-related shifts in call characteristics of the defeated great gerbils Rhombomys opimus // 6th International Zoo and Wildlife Research Conference on Behaviour, Physiology and Genetics, Berlin, IZW, 2007, p. 77. ... Sibling aggression in lynx: traits and consequences // Advances in Ethology 38, Supplements to Ethology. ... Advances in Ethology, Contributions to the 5-th International Symposium on Physiology, Behaviour and Conservation of Wildlife. ...

Еще в разделе: (Показать все результаты (>48) - vertebrata.bio.msu.ru/ )

• Courses

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>14) - sbmg.geol.msu.ru/ )

• ТРЕХМЕРНОЕ ГЕОЛОГИЧЕСКОЕ КАРТИРОВАНИЕ: ВВЕДЕНИЕ В ПРОБЛЕМУ
• Специальные символы HTML
• Список элементов HTML

. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the

Еще в разделе: (Показать все результаты (>6) - optics.sinp.msu.ru/ )

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... Ї theory of light: from vibration of ether to wave-particle duality Ї laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>4) - oc.cs.msu.ru/ )

... Q: How the defects induced by mechanical treatment affect Li diffusion? ... Q: Charging curves for LiFePO4 and LiMn2O4 demonstrate the capacity above theoretical value, which means contribution from electrolyte reduction. Are these capacities reliable? No, the experimental specific charge capacity of LiFePO4 is < 170 mAh/g (theoretical value) and that of LiMn2O4 is < 147 mAh/g (at 4 V range). ...

Еще в разделе: (Показать все результаты (>15) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/probst.pdf
• http://www.elch.chem.msu.ru/mole/lecture/malev.pdf
• http://www.elch.chem.msu.ru/mole/lecture/basilevsky.pdf

Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... Decision Sciences . Decision Sciences Journal of Innovative Education . ... Dermatologic Surgery . Dermatologic Therapy . ... Development and Change . Development Policy Review . Development, Growth & Differentiation . Developmental Medicine & Child Neurology . Developmental Science . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>7) - wwwlib.phys.msu.ru/ )