PHYSICAL REVIEW A 68, 022309 2003 Entangling quantum measurements and their properties B. A. Grishanin* and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, 119899 Moscow, Russia Received 20 December 2002; published 20 August 2003 We study the mathematical structure of superoperators describing quantum measurements, including the entangling measurement --the generalization of the standard quantum ...

Еще в разделе: (Показать все результаты (>66) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA-2000-61-52305-en.pdf
• http://qilab.phys.msu.ru/papers/UFN-2001-44(6)-en.pdf
• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

... Hello everybody out there using minix - I'm doing a (free) operating system (just a hobby, won't be big and professional like gnu) for 386(486) AT clones. ... I'd like any feedback on things people like/dislike in minix, as my OS resembles it somewhat (same physical layout of the file-system (due to practical reasons) among other things). ... This implies that I'll get something practical within a few months, and I'd like to know what features most people would want. ...

Еще в разделе: (Показать все результаты (>2) - al.cs.msu.ru/ )

. Click here to start INTAS 95-525 main page.

Еще в разделе: (Показать все результаты (>2) - composite.msu.ru/ )

• INTAS 95-525 Final Reprort (Short version)

Dear friends, It is less than three weeks left till the 39th IChO starts. ... Currency and cards. Russian rouble is the only currency accepted throughout Russia. ... To attention of Head mentors intending to pay fees on arrival in cash: payments will be accepted in Russian roubles only. ... During the IChO, mentors and guests will stay in Holiday Inn Sokolniki, and students in the Olympian camp, which is also an option for early arrivals and late departures. ... The 39th IChO Organizing Committee ...

Еще в разделе: (Показать все результаты (>2) - icho39.chem.msu.ru/ )

• 39th INTERNATIONAL CHEMISTRY OLYMPIAD

. Warning : Cannot modify header information - headers already sent by (output started at /wcmc/ndsipu/ndsipu/phpthumb/phpthumb.class.php:3947) in /wcmc/ndsipu/ndsipu/student.php on line 84 .

Еще в разделе: (Показать все результаты (>5) - ndsipu.cmc.msu.ru/ )

... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>2) - netadmin.chem.msu.ru/ )

Contemplating the evolution of Surface Nonlinear Optics seems to be highly instructive, able to stimulate one's own creativity and deeper understanding of current trends in this field. ... Hence, the Surface Nonlinear Optics Map, in its starting version, presents the names of researchers having made prominent scientific contributions to this branch of Optics. Related websites are accessible by clicking the corresponding names. ...

Еще в разделе: (Показать все результаты (>23) - shg.phys.msu.ru/ )

• Milestones of the lab highway

. General Information . Media Files . Participants . Timetable . Local Information . Photos . Dear Participants! . We would like to thank everybody for coming and we hope that conference was fruitful for you. According to decision that was taken during discussion on the first day of the conference all presentations will be published on this website in section Media Files (with references from timetable) starting with summary of conference by Marc Sarazin.

Еще в разделе: (Показать все результаты (>17) - site2010.sai.msu.ru/ )

• General information

Заседание семинара по социофизике . ... These studies are based on the quantum-like paradigm (elaborated by the speaker): processing of information by complex context-sensitive systems has to be described by nonclassical probabilistic models: there is a plenty of statistical data which violate the laws of classical probability (or what is equivalent the laws of classical Boolean logic). ... Quantum-like modeling of cognition . ... Вебдизайн: Copyright (C) И. Миняйлова и В. Миняйлов . ...

Еще в разделе: (Показать все результаты (>2) - www.soc-phys.chem.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

LabVIEW. ... National Instument DAQ, LabVIEW LPT COM , GPIB . ... RS-232 GPIB . RS-232 / GPIB, LabVIEW. ... RS-232 IEEE-488 (GPIB). ... RS-232 , DTE (Data Terminal Equipment) -- ( ), -- DCE (Data Communications Equipment) -- ( ). DTE () -- , DCE () -- , RS-232 (, , ), . ... LabVIEW, National Instruments http://ni.com/support/gpib/versions.htm. ... VISA Read COM Receive GPIB ), , . VISA Write Send COM GPIB . ... VISA Read Receive , «read buffer» ( «data string» GPIB) Create\Indicator. ...

254. Центр по делам России и США :: Публикации

255. Background of the Department

256. http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf

257. http://arts.msu.ru/freefiles/Faculty%20of%20Arts.pdf