. Область научных интересов . Сотрудники, приглашенные специалисты и студенты . Информация о научных конференциях и семинарах . Основные публикации . Наш адрес . Home page .
... Information for the applicants . ... News . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Faculty of Bioengineering and Bioinformatics, office 433. ... 2016 Faculty of Bioengineering and Bioinformatics, . Lomonosov Moscow State University . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Probe flash (energy/duration) . ... 0.01 J / 0.01 ms . ... Submersible unit (dimension/weight) . Power supply unit (dimensions/weight) . ... 300 x 300 x 50 mm / 1 kg . ... Power supply . ... The complete set of PrimProd fluorometer consists of the following mainframes: submersible probe, 12 DC on-board block power supply, IBM-compatible computer, connecting cables and cable-rope. ... Submersible probe. ... On-board power block provides the necessary voltage (42 V) supply at the submersible probe. ...
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
МГУ имени М.В.Ломоносова Русская версия . ... The beginning and end of the event . ... Africa /Abidjan Africa /Accra Africa /Addis_Ababa Africa /Algiers Africa /Asmara Africa /Bamako Africa /Bangui Africa /Banjul Africa /Bissau Africa /Blantyre Africa /Brazzaville Africa /Bujumbura Africa /Cairo Africa /Casablanca Africa /Ceuta Africa /Conakry Africa /Dakar Africa /Dar_es_Salaam Africa /Djibouti Africa /Douala Africa /El_Aaiun Africa /Freetown ... МГУ имени М.В. Ломоносова . ...
Department of Physics, Lomonosov Moscow State University . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. ... Division of Atomic Physics, Plasma Physics, and Microelectronics . ... Faculty of Physics . ... Atomic Physics, Plasma Physics, and Microelectronics Division . ...
Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...
. Московский государственный Университет . им. М.В.Ломоносова . Главная страница . Уставные документы . Об истории физического факультета . Литературная страница . База данных выпускников . Курсовые страницы . Уточнить информацию о выпускнике . 50 лет ССО . Объявления Совета выпусков . Наши реквизиты . Образцы документов . Наши ссылки . Социальная сеть Союза Выпускников . Оформление Гусаковой Д.Ю. , Web-программирование Тарасов А.Б. Тел. Союза выпускников 939-32-84 Administrator
... Faculty of Soil Science, Moscow State University . ... Evaluation of acid deposition effects on soils as a component of forest ecosystems. ... Estimation and prediction of forest soil response to acid deposition with simple process-based models. ... Forest soil response to acid deposition, in particular the significance of soil organic matter in the processes of proton consumption, sulphur retention, aluminium and heavy metals mobilisation was investigated. ... Acid Deposition and Forest Soils. ...
... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...