... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...

Еще в разделе: (Показать все результаты (>7) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...

Еще в разделе: (Показать все результаты (>47) - www.lssm.inorg.chem.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...

Еще в разделе: (Показать все результаты (>10) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf

Development of new approaches to the analysis of ring shapes in organic molecules and the description of electronic distribution (atomic charges) and halogen bonding in the framework of forcefield model for rapid estimation of intra- and intermolecular interaction energies in molecular mechanics, molecular dynamics and docking methods . Forcefield is a model and a set of parameters for theoretical description of intra- and intermolecular interactions. ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>20) - qsar.chem.msu.ru/ )

• Research - Laboratory of Medicinal Chemistry
• Radchenko, Eugene V. - Laboratory of Medicinal Chemistry

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>22) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ
• Similarity analysis of the streamer zone of Blue Jets
• Publications on Transient luminous events

1, 120103 (2012) . ... 2012 120103-1 1, 120103 (2012) . ... xi ,yk ) : i,k =- 3 ( hy 2 i,k-1 - i,k 1 )- 2 i,k-1 . ... 2 2 + 2 i,k = hx2 hy i-1,k +i+1 = hx2 ,k + i,k-1 + hy 2 i,k+1 + i,k . ... 1, 120103 (2012) max 2, max -- ; -- . ... 2012 120103-8 1, 120103 (2012) Numerical mo delling of propagation pro cess and sedimentation of ablated particles in the scheme of a direct laser dusting . ... 492) 247-96-21, e-mail: aantipov@vlsu.ru. 2. -- .-. , ; .: (492) 253-33-58 e-mail: aarak@vlsu.ru. 3. -- ; . ...

Еще в разделе: (Показать все результаты (>3) - uzmu.phys.msu.ru/ )

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. February 7, 1998 . COBE Hotspots: The Oldest Structures Known . ... After computer processing to remove contributions from nearby objects and the effects of the earth's motion , the map shows temperature variations in the early Universe as red "spots". These spots are the oldest, most distant structures known. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>16) - www.arcetri.astro.it/ )

• APOD: 2000 December 29 - The Dark Horsehead Nebula

Science . ... For 1st and 2nd-year students . Introduction to quantum physics . ... 2nd-year course work topics . ... For the history of our department a formal reference point is 1978 , when as a result of the reorganization of the Department of Wave Processes in the Physics Department of Moscow State University have two new departments : General Physics and Wave Processes ( OFVP ) and our department (up to 2001 - quantum physics, in 2001 renamed the Department of Quantum Electronics). ...

Еще в разделе: (Показать все результаты (>3) - quantum.phys.msu.ru/ )

... Kinetics of optical tweezers (OT)-induced spontaneous aggregation and disaggregation of red blood cells (RBCs) were studied at the level of cell doublets to assess RBC interaction mechanics. ... 1 Introduction Red blood cell (RBC) aggregation is the reversible clumping of cells under low-shear forces or at stasis. ... 1.4 Fibrinogen-Induced Red Blood Cell Aggregation 1.3 Factors Affecting Red Blood Cell Aggregation The factors affecting aggregation of RBCs can generally be separated into two parts. ...

Еще в разделе: (Показать все результаты (>81) - nanolab.phys.msu.ru/ )

• Ultrafast plasmonics and magnetoplasmonics | Laboratory of Nanophotonics &
• About the laboratory | Laboratory of Nanophotonics & Metamaterials
• Optical tweezers and photonic force microscopy | Laboratory of Nanophotonics &

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>7) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры

... изображений в медицине . ... Темы включают: сбор данных, обработка изображений, фильтрация, кодирование, анализ специфических данных и моделирования. ЧАСТЬ 1 - Основы детерминированных сигналов и обработки изображений . ... Discrete-Time Signal Processing. 2nd ed. Upper Saddle River, NJ: Prentice-Hall, 1999. ISBN: 9780137549207. ... ISBN: 9780072817256. ... Signals and Systems. 2nd ed. Upper Saddle River: Prentice-Hall, 1996. ... Upper Saddle River, NJ: Prentice-Hall, 1978. ...

Еще в разделе: (Показать все результаты (>10) - medphys.phys.msu.ru/ )

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

... Creating the WebStatistics topics . ... The script can be run two ways: . ... The following form can be used to run statistics and create the WebStatistics topics for selected or all webs. ... By default, the statistics script may be run by anyone, however the user must have CHANGE permission on the WebStatistics topic. ... The bin/statistics script can also be executed as a CGI script, Use the form at the top of this topic to run statistics. ... This topic: System > WebHome > SiteToolStatistics . ...

Еще в разделе: (Показать все результаты (>1826) - wiki.cs.msu.ru/ )

• (backlinks in System Web) WebLeftBarCookbook < System < Foswiki
• (backlinks in all Webs) FileAttribute < System < Foswiki
• (backlinks in System Web) MacrosQuickStart < System < Foswiki

... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...

256. Laboratory of Mechanics of Multiphase Media

257. Anton O. Belyakov

258. About Us

259. http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011_en.pdf

260. http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=39&from=&ref_ind=0511102279