... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
MEASUREMENT OF PHYTOPLANKTON PHOTOSYNTHESIS RATE USING A PUMP-AND-PROBE FLUOROMETER . ... A biophysical model was used to describe the relationship between photosynthesis, underwater radiation, and the intensity of phytoplankton fluorescence excited by an artificial light source. ... Parameters of the model that could not be measured experimentally were determined by calibrating fluorescence and radiation data against the primary production measured in the Baltic Sea by radioactive carbon method. ...
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... About Conference . ... Asian and African Studies . ... Art Criticism and History . ... Section Mathematics and mechanics . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... In April 2016 Lomonosov Moscow State University will hold the XXIII Lomonosov International Conference for Students and Young Scientists within the International scientific youth forum "Lomonosov-2016". ...
ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...
Department of Physics, Lomonosov Moscow State University . ... Journal of Applied Physics 117 љ(2015), 125704?1?125704?5. DOI љ] . Kornev, V., Sharafiev, A., Soloviev, I., and Mukhanov, O. Signal and noise characteristics of bi-squid.љ Superconductor Science and Technology 27 љ(2014), 115009. ... Journal of Applied Physics 116 љ(2014), 043904. ... Journal of Applied Physics 91 , 5 (2002), 3049?3053. ... Journal of Applied Physics 90 , 5 (2001), 2411?2415. ... Publications . ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
TUS/KLYPVE Program for Observation of Extreme Energy Cosmic Rays from Space B.A. Khrenov DV Skobeltsyn Institute of Nuclear Physics of MV Lomonosov Moscow State University Workshop "Cosmic Ray Large Scale Experiments in the Second Decade of the 21st Century" 17 May 2011 TUS/KLYPVE collaboration SINP MSU, JINR (Dubna), RSC "Energia", Consortium "Space Regatta" EWHA University (Seoul, Korea) Puebla University (Mexico) Universities of Japan, RIKEN (Tokyo). ... Digital oscilloscopes for UV flashes. ...
... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... The Department of Television and Radio Broadcasting was established in 1958. The department was the first in the USSR and in Russia, where the theoretical foundations of television and radio broadcasting were studied and taught.љ ... Textbooks and monographs written by professors and lecturers of the department are widely used in Journalism Schools both in Russia and abroad. ...
Страница поддержки курса "Алгоритмы и алгоритмические языки" для 1 потока . ... Older posts . Posted on 15.01.2016 by abel . ... Второй коллоквиум по курсу состоится в субботу 05 декабря на первой паре. ... В секции рекомендуемой литературы обновлены ссылки на электронные версии методических пособий:љ 1) по языку Си и алгоритмам, 2) по экзаменационным задачам прошедших лет. ... Лекции по АиАЯ для первого потока будут проходить по средам и субботам в аудитории П6 на первой паре. ... Курс АиАЯ . ...
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Created 10 Aug 2008 - 17:36 . ... The preliminary test version of the Automation for Scientific Research Department English edition website has been released. Current content includes general information about the department , list of teachers and researchers , courses of study , contact information and some news. ... Source URL: http://ani.cs.msu.su/en/news-2008-08-10-english-edition . ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
... MSU Chamber Orchestra . ... G .F. Handel. Cara sposa" - Symphony and Air of Rinaldo. G.F.Handel "Mi credi in fedele.. Air of Siroe . ... Air of Goffredo from "Rinaldo". ... Moscow State University Chamber Orchestra. Handel and Graupner . ... Soprano air from "Messiah" . G.F. Handel "Il vostro maggio.. Song of Syrenes from "Rinaldo") . G. F. Handel - Theodora - "To thee, thou glorious son of worth.. G.F.Handel - Orlando - "Fammi combattere" . ...
. Fatal error : Cannot redeclare get_category_tree() (previously declared in /home/virtwww/w_bukivedi-ru_fa80b1aa/http/templates/xtc4/source/boxes/categories_all.php:11) in /home/virtwww/w_bukivedi-ru_fa80b1aa/http/media/content/sitemap.php on line 50 .
MSU . Science Park . ... Procurement regulations (see below - Regulations) control the procurement of goods, works and services (see below - Product) to satisfy the needs of CJSC "Science Park of Moscow State University" (see below - Customer). These regulations define procurement procedures, including the content, sequence, scheduled procedure timetables and the conditions of application. RU) Procurement regulations of MSU . ... JSC MSU Science Park. Phone: (495) 930 8454, 930 8455 . ...