... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...

Еще в разделе: (Показать все результаты (>12) - storage.bioinf.fbb.msu.ru/ )

... 000, 1ґ13 (2010) Printed 21 September 2011 A (MN L TEX style file v2.2) A universal ultraviolet-optical colourґcolourґmagnitude relation of galaxies I1gor V. Chilingarian1,2, and Ivan Yu. ... Received 2011 Sep 15; in original form 2011 Feb 6 ABSTRACT The bimodal galaxy distribution in the optical colourґmagnitude diagram (CMD) comprises a narrow "red sequence" populated mostly by early-type galaxies and a broad "blue cloud" dominated by star-forming systems. ...

Еще в разделе: (Показать все результаты (>2) - kcor.sai.msu.ru/ )

• http://kcor.sai.msu.ru/arXiv1002.2360.pdf

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>9) - tukachev.flogiston.ru/ )

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>14) - lmmqsp.sinp.msu.ru/ )

... Sparse matrix package . ... Памяти безразмерный параметр . Nondimensional memory parameter . ... Parallel flow . ... The line parallel to the tangent $k(S^{(1)})$ at the point $x$ . ... The particles impart (transfer) their energies to the fragments resulting from (the) collision . ... Front (anterior) surface of a (the) body . ... Transport field . ... Under the above transformations, the set $X$ goes into a set $Y$ . ... Electric field across the body surface . ... Flow-and-temperature field . ...

Еще в разделе: (Показать все результаты (>177) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/list_wrk/ps1/ch3st4.ps
• http://num-anal.srcc.msu.su/eng_math/redict/3.htm
• http://num-anal.srcc.msu.su/eng_math/redict/17.htm

... В данном разделе приводятся публикации проекта по созданию семейства реконфигурируемых вычислительных систем в рамках государственного контракта N 02.524.12.4002 от 20 апреля 2007 г. федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы". ... Материалы Международной научной конференции "Параллельные вычислительные технологии" (ПаВТ 2008), г. Санкт-Петербург, 29 - 31 января 2008, Россия. ... Минск,...

Еще в разделе: (Показать все результаты (>5) - fpga.parallel.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Nikolai V. Koronovsky professor, head of the Department of Dynamic Geology . Anatoly M. Nikishin professor, head of the Department of Regional Geology and Earth History . ... Viktor I. Starostin professor, head of the Department of Geology and Geochemistry of ore deposits . Antonina V. Stupakova professor, head of the Department of Geology and Geochemistry of oil and gas . ... Mikhail V. Borisov professor, head of the Department of Geochemistry . ...

Еще в разделе: (Показать все результаты (>20) - conf.msu.ru/ )

... About choir . ... Conductor . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Askerov Mirza-Aga Saftarovich , born in 1959, honored cultural worker of the Russian Federation, honored worked of the All-Russian Musical Society, candidate of pedagogical sciences. ... Since 1990 has been working with the Academic Choir of Moscow State University on the recommendation of professor V.V. Baranov, the honored cultural worker of the Russian Federation. ...

250. Current Projects

251. http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

252. http://atm563.phys.msu.ru/rus/gidromet_public_html/trudy/thmc3440112.pdf

253. Summer School 2016

254. TEPA 2012 | Thunderstorms and Elementary Particle Acceleration

255. Инструкции для преподавателей по работе в системе дистанционного обучения

256. http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Oct28-Nov5_2007.doc

257. Electron Beam Laboratory

258. http://www.geol.msu.ru/obsh/2012/Anounce2012.pdf

259. http://geonew.phys.msu.ru/junior_students/course_quot_fundamentals_of_geophysics_and_ecology_quot/2011%20Lecture%2002.pdf

260. Laboratory of Electrical Double Layer and Electrode Kinetics