Embedding formulae for Laplace-Beltrami problems on the sphere with a cut. ... Introduction We are considering the scalar problem of plane wave diffraction by a quarter-plane. ... Applying the BesselSommerfeld technique he has obtained the following formula for the diffraction co efficient: ^ i f ( , 0 ) = e-i g ( , 0, ) d, (1 ) where 0 and are directions of incidence and scattering, is the separation parameter and g is the Green's function of the of the spherical problem. ...

Еще в разделе: (Показать все результаты (>40) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/ursi1.pdf
• http://acoustics.phys.msu.su/teachers/gusev_files/diff2012.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/weinstein09.pdf

... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...

Еще в разделе: (Показать все результаты (>27) - silab.sinp.msu.ru/ )

... Bohm limit DB=vrg/3: Emax Emax ush 0.3 Ze B Rsh c 1014(B/Bism) Z eV B Hillas criterion ! ... Voelk 2000; Kang Jones 2006) - Bohm diffusion in amplified magnetic field B2/8 = 0.035 u2/2 ( Voelk et al. 2005 empirical; Bell 2004 , Zirakashvili VP 2008 theoretical) - account for Alfvenic drift w = u + Va upstream and downstream - relative SNR rates: SN Ia : IIP : Ib/c : IIb = 0.32 : 0.44 : 0.22 : 0.02 Chevalier 2004 , Leaman 2008, Smart et al 2004, Berezinsky et al 2006 Das et al. ...

Еще в разделе: (Показать все результаты (>6) - tunka.sinp.msu.ru/ )

... A barrel consisting of scintillation crystals has several advantages over a lead-scintillator design, including higher sensitivity and greater ease of segmentation. ... The CsI detector (called CID) consists of two parts: a CsI Barrel (CIB) of 10 rings with 18 crystals per ring; and a single upstream 1%crystal CsI Ring (CIR) with somewhat larger crystals than those in the barrel. ... Diagram of a CsI crystal. ... Shown in Fig. 12 is a typical pulse-height spectrum for one crystal for a halo data run...

Еще в разделе: (Показать все результаты (>58) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/NIM_2prot-LGD.pdf
• http://lav01.sinp.msu.ru/nir/papers/NIM_Unique-Sci-D.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/Porteboeuf-Houssais_AFTER_Mai2012_AMPT.pdf

... Useful Information . ... Vestnik CIE (in Russian) . ... Information about Russia . ... With an area of 17,075,200 square kilometres, it is the largest country in the world by land mass, covering almost twice the territory of the next-largest country, Canada. ... Formerly the dominant republic of the Union of Soviet Socialist Republics (USSR), Russia is now an independent country and an influential member of the Commonwealth of Independent States, since the Union s dissolution in December 1991. ...

Еще в разделе: (Показать все результаты (>20) - www.cie.ru/ )

• Certification :: Les programmes d?enseignement :: CEI
• Elective Courses :: Academic Programmes :: CIE

... Publications . ... G.V. Maksimov, E.Z. Bibineyshvili, A.I. Yusipovich, G.G. Levin, and A.B. Rubin. ... N.A. Brazhe, E.Y. Parshina, V.V. Khabatova, A.A. Semenova, A.R. Brazhe, A.I. Yusipovich, A.S. Sarycheva, A.A. Churin, E.A. Goodilin, G.V. Maksimov, and O.V. Sosnovtseva. ... A.A. Semenova, E.A. Goodilin, N.A. Brazhe, V.K. Ivanov, A.E. Baranchikov, V.A. Lebedev, A.E. Goldt, O.V. Sosnovtseva, S.V. Savilov, A.V. Egorov, A.R. Brazhe, E.Y. Parshina, O.G. Luneva, G.V. Maksimov, and Y.D. Tretyakov. ...

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

• archives

... For physics faculty . ... Number of lecturers and Professors: 28. ... Head of the Department : prof. D.R. Khokhlov. ... D.R. Khokhlov Doctor of Sciences (Physics and mathematics), Professor, Correspondent Member of the Russian Academy of Sciences. ... B.A.Strukov Doctor of Physics and Mathematics, Professor. ... Field of science activity: magnetic properties of solid state, rare earth magnets, itinerant magnetism, magnetic phase transitions . ... Head of the laboratory of Magnetic Semiconductors. ...

Еще в разделе: (Показать все результаты (>36) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

... A dimension that, arguably, has so far not received the attention it deserves, namely: the role of research and education in fighting the spread of terrorist ideology and enhancing information security. ... To conclude, I will make some concrete suggestions about what kind of research we need and what kind of educational programmes we should develop to address the spread of terrorist ideology and to enhance cyber security. ... Ideology can potentially play different roles in the context of terrorism...

Еще в разделе: (Показать все результаты (>12) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc
• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf
• http://www.iisi.msu.ru/UserFiles/File/nostr/d_3-3.doc

... Using the CFBDSIR wide field survey for brown dwarfs, we identified CFBDSIRJ214947.2-040308.9, a late T dwarf with atypically red J-Ks colour. ... SN 2009ip in NGC 7259 Electronic Telegram No. ... 7.09, [19.0; 2009 Aug. ... Accepted for publication in MNRAS Subjects: High Energy Astrophysical Phenomena (astro-ph.HE) The jet opening angle theta_jet and the bulk Lorentz factor Gamma_0 are crucial parameters for the computation of the energetics of Gamma Ray Bursts (GRBs). ...

Еще в разделе: (Показать все результаты (>204) - master.sai.msu.ru/ )

• http://master.sai.msu.ru/media/presentations/2012/VST_seminar_Abstract_2.pdf
• YaB-100 - Asteroid
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>6) - uneex.cs.msu.su/ )

... High Power Linear Accelerators . Fig 3a: One-section schematic . ... Our CW LINAC family consists of ten accelerators each with beam currents of 50 mA and energies ranging from 0.6 to 6 MeV in increments of 600 keV with corresponding beam power of 30 to 300 kW. ... Fig 4a: Two-section schematic . ... Our two-section CW LINAC seen in Fig. 4 consists of one-section CW LINAC, beam line between first and second AS, and second AS which accelerates the 50 mA beam up to the energy 1.2 MeV. ... 0.6 MeV . ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

• RTM-CS

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>10) - wwwlib.phys.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>2) - www.eng.geogr.msu.ru/ )

• Selenga-Baikal research

... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...

Еще в разделе: (Показать все результаты (>22) - polit.msu.ru/ )

• http://polit.msu.ru/pub/fl-doc/Spanish.doc
• http://polit.msu.ru/pub/fl-doc/French.doc
• Профессор Елена Борисовна Шестопал приняла участие в конференции Кембриджского

... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...

Еще в разделе: (Показать все результаты (>2) - sphere.sinp.msu.ru/ )

... Публикации . ... Vassiliev, Dmitrii V. Glukhov, Galina A. Tsirlina, Michael Probst . ... Galina Tsirlina, Evgeny Antipov, Dmitrii Glukhov, Alexander Gusev, Veronika Laurinavichute, Renat Nazmutdinov, Dmitry Simakov, Sergey Vassiliev, Tamara Zinkicheva . ... Sergey Vassiliev, Veronika Laurinavichute, Zoya Kuz'minova, Galina Tsirlina, Evgeny Antipov, Alexander Gusev, Dmitry Simakov . ... Кристаллохимические и электрохимические аспекты исследования проблемы "интертного" анода . ...

258. http://mguteam.chat.ru/roster1.html

259. http://lvk.cs.msu.su/~dimawolf/ArchEVM/Lection12.pdf

260. Русско-германский институт.