... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Жизнь факультета . ... The course will include clinical cases and lectures on general cardiology and additional knowledge of interventional cardiology, cardiovascular imaging (echocardiography, cardiac CT, CMR, nuclear and PET scan), cardiovascular intensive care, electrophysiology and device therapy, advanced heart failure and transplantation, cardiac rehabilitation and prevention, grown-up congenital heart disease (GUCH), genetic and regenerative cell treatment of cardiovascular diseases. ...

Еще в разделе: (Показать все результаты (>12) - fbm.msu.ru/ )

Экосистемный подход к управлению природными ресурсами и экосистемой: концепцией, принципы и применение / Zhou Yang-ming, Yu Xiu-bo, Yu Gui-rui // Adv. ... В соответствии с конвекцией по биологическому разнообразию, экосистемный подход является стратегией по объединенному управлению землей, водой и живыми ресурсами. Экосистемный подход не является конкретным методом, а стратегией управления экосистемой. Экосистемный подход используется в управлении природными ресурсами и бассейнами рек. ...

Еще в разделе: (Показать все результаты (>8) - ecoinformatica.srcc.msu.ru/ )

FOSTERING EARTH SCIENCE LEADERS THE SECOND CONTEST OF GEO-STUDENTS . .. PEARSO N-LONG MAN 2013 2- - - GEOLOGY IN THE 21st CENTURY ? ? ? ? ? ­ !!! 16 2012 msu.konkurs@mail.ru 19 30 - - Pearson-Longman 2013 - Pears onLongman

Еще в разделе: (Показать все результаты (>5) - geol.msu.ru/ )

• http://www.geol.msu.ru/obsh/uch_ch2.doc

... H2O, CO2 . ... v << v K2 kT m << GM R *** ~5 ·1018 ~6 ·1024 90% 16.3 99% 32.2 6371 «Standard Atmosphere» p = p0e -z / H H 8 % 78.11 20.957 0.937 % CO2 0 ­7 0.01 ­ 0.1 0 ­ 0.01 N2 28.016 O2 31.9986 Ar 39.942 Ne 20.182 He 4.003 Kr 83.80 Xe 131.3 H2 2.016 CH4 18.043 N2O 44.015 % 78.110 20.957 0.937 0.001818 0.000524 0.000114 0.0000087 0.00005 0.0002 0.00005 % H2O 18.005 0­7 O2 44.009 0.01 ­ 0.1 - 0.032 O3 47.998 0 ­ 0.01 SO2 64.064 0 ­ 0.0001 NO2 46.007 0 ­ 0.000002 «Standard Atmosphere» . ...

Еще в разделе: (Показать все результаты (>2) - geonew.phys.msu.ru/ )

Program XXXVI International Conference of the Russian Society for American Culture Studies Nature and Sustainability of Culture Moscow, December 3-10, 2010 Section 1. ... Nature in the nineteen-century American culture (The concept of Nature and its evolution from Romanticism to Naturalism. ... O.Y. Danchevskaya Moscow State Pedagogical University, Moscow, Russia Concept of Soul among North American Indians Soul is probably the most vital notion in any religion, though ideas about it vary greatly. ...

Еще в разделе: (Показать все результаты (>63) - www.journ.msu.ru/ )

• News :: Department of Journalism, M. V. Lomonosov Moscow State University <span
• History and Statutory Regulation of Domestic Mass Media :: Department of
• The students of the Faculty of Journalism visited Hamburg Media School ::

Research paper Struct Multidisc Optim 27, 435 ­ 445 (2004) DOI 10.1007/s00158-004-0388-x Optimal shapes of parametrically excited beams A.A. Mailybaev, H. Yabuno, and H. Kaneko Abstract Straight elastically supported beams of variable width under the action of a periodic axial force are considered. Two shape optimization problems for reducing parametric resonance zones are studied. In the first problem, the minimal (critical) amplitude of the excitation force is maximized. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/marchesinmailybaev2008b.pdf
• Dr Alexei A. Mailybaev

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>12) - magn.phys.msu.ru/ )

• Information about education on magnetism division

. Меню . Главная Поиск О проекте Форум Control Panel Алгебра Математический анализ Действительный анализ Комплексный анализ Функциональный анализ Геометрия/Топология Логика/Дискра Механика ОДУ/УрЧП Оптимальное управление ТеорВер/МатСтат Теория чисел Физика ЧМ/Программирование Курсы ЕНС Нематематика TeX/MetaPost Книги Ссылки Wanted . Control Panel . Пароль: . Copyright 2003 ? 2016, DMVN . All rights reserved

Еще в разделе: (Показать все результаты (>604) - www.dmvn.mexmat.net/ )

• Учебные материалы DMVN ::

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . PhD, scientist Galina Ya. Pushkina . ... Synthesis and investigation of physicochemical properties of complex phosphates and vanadates of alkali and alkali-earth metals. ... Synthesis and characterization of solid solution in ABCO 4 system. ... Неорган. материалы, 2005, т.41, ?8, с.1-4. ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>55) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials

Вы посетили: arzhantsev_s_a_publications . ... История кафедры . ... On restriction of roots on affine T-varieties, Beitr?ge zur Algebra und Geometrie / Contributions to Algebra and Geometry 55 (2014), no. ... Journal of Pure and Applied Algebra 218 (2014), no. ... Сибирский математический журнал 53 (2012), вып.6, 1354-1372 . ... Математический Сборник 203 (2012), вып.4, 47-60 . ... staff/arzhantsev_s_a_publications.txt Последние изменения: 10.05.2015 22:32 От arjantse | ...

Еще в разделе: (Показать все результаты (>23) - halgebra.math.msu.su/ )

• staff:arzhantsev_publications | Кафедра высшей алгебры

... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...

Еще в разделе: (Показать все результаты (>4) - siberian-lang.srcc.msu.ru/ )

Pergamon 80006-3509(96)00053-1 BEHAVIOUR OF THE MITOTIC APPARATUS AFTER ULTRAVIOLET MICROIRRADIATION OF THE SPINDLE POLE* R. E. UZBEKOV and I. A. VOROB'YEV Belozerskii Institute of Physico-Chemical Biology of the Lomonosov State University, Moscow (Received 18 July 1995) The results of the effect of u.v. microirradiation of the centrosome (mitotic spindle pole) on cell division in the metaphase and anaphase are discussed. ... The irradiated pole is on the right. ... Irradiated pole is on the right. ...

Еще в разделе: (Показать все результаты (>37) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/PNAS_2001.pdf
• publications
• publications2

... 000, 1­12 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...

Еще в разделе: (Показать все результаты (>2) - kcor.sai.msu.ru/ )

• http://kcor.sai.msu.ru/arXiv1102.1159.pdf

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

• List of Publications of Prof. Alexander P. Seyranian

THE PROBLEM OF COUNABILITY OF HIGHEST ORDINALS . ... The first form corresponds to the geometric representation of ordinal w n as an infinite n -dimensional matrix. According traditional formulation w w = U w i , i =1, w , thus w w is w -countable union of countable ordinals so w w is countable. ... TWO METHODS OF RENUMBERING OF ELEMENTS OF ORDINALS The fist infinite ordinal w designates the set of natural numbers which is countable by definition. ... This matrix represents ordinal w (w ^ w) . ...

Еще в разделе: (Показать все результаты (>14) - www.protein.bio.msu.ru/ )

• ITOG\sttit1

SIDA training in Sweden . Arthur R.Lyandzberg, Inna A.Novikova 22 февраля 2002 00:17:15 . ... Sida Country info Sector info Publications Training Programmes . ... Environment . Local Environment Management . ... Land Administration Geographical . ... Urban Land Management . ... Integrated Water Resources Management . ... Operational Hydrology, Technology Management . ... Contents:Hydrological problems, water management and general hydrology . Authorities, legislation and policies . ...

Еще в разделе: (Показать все результаты (>14) - www.ecocoop.ru/ )

• http://www.ecocoop.ru/zoology/archive1/messages/424.html
• For three and half years of activity the participants of Ecological Cooperation

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>3) - math.phys.msu.ru/ )

ITPM MSU . Quantum Computing Page . ... Quantum Computation/Cryptography at LosAlamos . Quantum Information at Los Alamos National Laboratory . Laboratory for Theoretical and Quantum Computing ( Universite de Montreal ) . Quantum information and quantum computation at IBM . ... Centre for Quantum Computation . Quantum Information Page . Quantum Information and Computation . ... Quantum Information and Quantum Computing (by Reinhard F. Werner) . ... c) ITPM MSU 1998, 1999 ...

260. A Little History