... Lectures, Questions & Answers . ... Evgeny V. Antipov (Faculty of Chemistry, Moscow State University) New cathode materials for lithium batteries . Questions and Answers . ... Questions . Vladimir I. Feldman (Faculty of Chemistry, Moscow State University) Physics and chemistry of solvated electron . ... Galina A. Tsirlina (Faculty of Chemistry, Moscow State University) Diversity of electrochemistry: the specific problems of molecular models and their experimental verification . ...
IEEE International Workshop on Intelligent Data Acquisition and Advanced Computing Systems: Technology and Applications 21-23 September 2009, Rende (Cosenza), Italy Web and Grid Services for Training in Earth Observation 1 Marian Neagul, Silviu Panica, Dana Petcu, Daniela Zaharie1, Dorian Gorgan 2 West University of Timisoara, Bd.V.Parvan ... CONCLU SIONS GiSHEO's platform promises to deliver real-time services for satellite data processing for training activities for Earth observation. ...
[
Текст
]
Ссылки http://angel.cs.msu.su/~oxana/image_processing/papers/2009-i09-104-final.pdf -- 1018.4 Кб -- 07.07.2009 Похожие документы
SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Shmeleva Elena Vladimirovna . ... Research interests - strategic and corporate governance, culture of innovation, HSE-management, talent management, corporate social responsibility, quality management system of higher education. ... The head of more than 200 research projects. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...
... E-mail: swan@mch.chem.msu.su (Received 0 XXXXXXX 0000; accepted 0 XXXXXXX 0000) The local environment of the Pb atom in Pbx Sn1 x S solid solution was studied by EXAFS technique. The shortest PbS bond length ° in orthorhombic samples was found to be by 0.2 A shorter than in cubic PbS. ... Strong correlations found in the distribution of metal atoms in the second shell show that the orthorhombic samples can be considered as solid solutions with unexpectedly strong short-range order. ...
[
Текст
]
Ссылки http://semiconductors.phys.msu.ru/publ/ma5376.pdf -- 246.9 Кб -- 12.03.2001
[
Текст
]
Ссылки http://scon155.phys.msu.su/publ/ma5376.pdf -- 246.9 Кб -- 12.03.2001 Похожие документы
... 36, Database issue doi:10.1093/nar/gkm882 Published online 12 December 2007 KEGG for linking genomes to life and the environment Minoru Kanehisa1,2,*, Michihiro Araki2, Susumu Goto1, Masahiro Hattori1, Mika Hirakawa1 ... Katayama2, Shuichi Kawashima2, Shujiro Okuda1, Toshiaki Tokimatsu1 and Yoshihiro Yamanishi1 1 Bioinformatics Center, Institute for Chemical Research, Kyoto University, Uji, Kyoto 611-0011, 2Human ... Thus, KEGG GENES can be used as a reference database for genome annotation. ...
[
Текст
]
Ссылки http://kodomo.fbb.msu.ru/FBB/year_07/term4/Block_2/Task3/KEGG2008.pdf -- 460.0 Кб -- 21.03.2008 Похожие документы
... P. Vabishchevich, M. R. Shcherbakov, V. O. Bessonov, T. V. Dolgova, A. A. Fedyanin . ... download . Maxim R. Shcherbakov, Polina P. Vabishchevich, Alexander S. Shorokhov, Katie E. Chong, Duk-Yong Choi, Isabelle Staude, Andrey E. Miroshnichenko, Dragomir N. Neshev, Andrey A. Fedyanin, and Yuri S. Kivshar . ... Frolov, Polina P. Vabishchevich, Maxim R. Shcherbakov, Tatyana V. Dolgova, Andrey A. Fedyanin . ... Frolov, P. P. Vabishchevich, M. R. Shcherbakov, T. V. Dolgova, A. A. Fedyanin . ...
The scientific and academic laboratory “Thermogasdynamics” was created according to the decision of the Rector of MSU, academician of the Russian Academy of Science Sadovnichyi V.A. and the Rector of MSTU, member-correspondent of the Russian Academy of Science Fedorov I.B. to extend scientific research and to use the unique equipment of hypersonic laboratory of the Institute of Mechanics, MSU. ...
... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...
... Иоанном (Реннето)] // Вестник Русского Западно-Европейского Патриаршего Экзархата . ... 105-108 (ВРЗЕПЭ) . ... Ф.Б. Introduction a la spiritualit de l'Eglise en Orient // Вестник Русского Западно-Европейского Патриаршего Экзархата . ... L' glise Orthodoxe de Roumanie // Вестник Русского Западно-Европейского Патриаршего Экзархата . ... L'Autocephalie de l'Eglise Orthodoxe Tchecoslovaque [Автокефалия Чехословацкой Православной Церкви] // Вестник Русского Западно-Европейского Патриаршего Экзархата . ...
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
... Администрация Химического факультета МГУ . ... Научный отдел Химического факультета МГУ создан в 1963г.. Деканом Химического факультета в те годы был профессор И.Ф. Луценко, а его заместителем по научной работе - профессор Ю.В.Филиппов. Курировали работу научного отдела со дня его основания заместители декана по научной работе - выдающиеся ученые факультета: В.М. Татевский, И.Ф. Луценко, Ю.В. Филиппов, Ю.Я. Кузяков, М.Я. Мельников, Б.А. Поповкин, О.А. Петрий, А.В. Анисимов. ... Отдел кадров . ...
... This book contains scientific papers prepared by researchers of Moscow State University and Autonomous University of Puebla in accordance with a special Russian--Mexican scientific program. ... Institute of Mathematical Studies of Complex Systems, Moscow State University . ... Institute of Nuclear Physics, Moscow State University . ... The book is edited by Rector of Moscow State University Dr. V.A. Sadovnichii and Rector of Autonomous University of Puebla Dr. E. Doger Guerero. ...
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы
... АНАТОЛИЙ ТИМОФЕЕВИЧ ТЕРЕХИН ANATOLY TEREKHIN (TERIOKHIN) . ... Будилова Е.В., Терехин А.Т. Математическое моделирование эволюции жизненного цикла: краткая история и основные направления// Журнал общей биологии, 2010. ... Ponton F., Duneau D., S?nchez M., Courtiol, A., Terekhin A.T., Budilova E.V., Renaud F., Thomas F. Effect of parasite-induced behavioral alterations on juvenile development. ... Терехин А.Т., Будилова Е.В. , Понтон Ф., Дюно Д., Санчес М., Мур Дж., ... Терехин А.Т., Будилова Е.В . ...