... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... Department of Vertebrate Zoology . ... Vertebrate Zoology - for the 1-year students (prof. L.P.Korzoun) . Special Vertebrate Zoology - elective course for the 2-year students studying zoology and botany (associate prof. S.V.Ogurtsov ) . ... Zoogeography (leading researcher V.V.Inanitskii) . ... Seminar 'Actual Problems of Vertebrate Zoology' - for the 5th year students (leading researcher M.E.Goltsman, researcher O.A.Filatova) . History of Zoology (leading researcher V.S.Shishkin) . ...

Еще в разделе: (Показать все результаты (>18) - vertebrata.bio.msu.ru/ )

• Department of Vertebrate Zoology

... Basic Linux . ... PCMCIA . Sound . ... CLEVO 8750 running X Window . ... BIOS: Phoenix (256Kb Flash ROM, PnP 1.0a, APM 1.2, LBA) LCD: TFT 13.3" 1024x768 . ... PCMCIA: GL9382; 2x Type II or 1x Type III PC Card slots (with ZV support) . ... Battery: Ni-Mh or Li-Ion . ... Nor X Window neither PCMCIA worked. ... For CLEVO 8750, I found at least two RRs at which X Window works: 62Hz and 70Hz. ... To enable the mouse when working on console use GPM with "-dev/psaux -t ps2" options. ...

Еще в разделе: (Показать все результаты (>2) - uranus.sai.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ AMPLITUDE EVOLUTION AND RUNUP OF SOLITARY WAVES ON A SLOPING PLANE Ahmet . ... 1999]; Carrier and Yeh, [2002]. ... Experimental data on runup of solitary waves are given among others by Hall and Watts, [1953], Pedersen and Gjevik, [1983] and Synolakis [1987], Shankar and Jayaratne, [2002], Lee and Raichlen, [2002]. ...

Еще в разделе: (Показать все результаты (>6) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E01_Armigliato.pdf

... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>17) - rswater.phys.msu.ru/ )

• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

... Access control . ... These criteria are called Authorization , Authentication , and Access control . ... This usually involves a username and a password, but can include any other method of demonstrating identity, such as a smart card, retina scan, voice recognition, or fingerprints. ... Configure Apache to use that file for authentication. ... Now, users accessing the directory will be required to authenticate against the list of valid users who are in /usr/local/apache/passwd/passwords.dat . ...

Еще в разделе: (Показать все результаты (>19) - neptun.sai.msu.ru/ )

• Hints on Running a High-Performance Web Server
• Apache module mod_auth_digest
• Manual Page: htpasswd - Apache HTTP Server

... It carries out the basic communication op erations, such as b oundary exchanges and transp ositions of decomp osed data. ... Data distribution b efore transp osition. б б бвб бв б б б бвбв б бв б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвбв б б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б бвб бв б б б б бвбв б бв бвбв б бв бвбв б бв бвбв б бв бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б ...

Еще в разделе: (Показать все результаты (>4) - geophys.srcc.msu.ru/ )

• Лаборатория суперкомпьютерного моделирования природно-климатических процессов

... About hotel . Services . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! Feel free to share your opinion about us .. Hotel "69 Parallel" offers its guests meeting room for meetings, seminars and presentations. ... The cost of the lease without the use of equipment is 200 rubles for one hour. ... Order: (8152) 253-700, reserv@69parallel.ru . ... The hotel "69 Parallel" gives you the following list of services: . ...

Еще в разделе: (Показать все результаты (>22) - 69parallel.ru/ )

• Hotel "69 Parallel" - Rooms and prices
• Hotel "69 Parallel" - Main
• Hotel "69 Parallel" - Guestbook

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>2) - margaret.imec.msu.ru/ )

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

... Опубликовано Июль 13, 2015 автором admin . ... Рубрика: новости . ... Российский фонд фундаментальных исследований и Фонд поддержки научно-проектной деятельности студентов, аспирантов и молодых ученых ?Национальное интеллектуальное развитие? подписали соглашение о проведении совместных конкурсов для молодых ученых. ... Опубликовано Июнь 29, 2015 автором admin . ... Опубликовано Май 28, 2015 автором admin . ... 2012 Центр национального интеллектуального резерва МГУ имени М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - cnir.msu.ru/ )

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>15) - lav01.sinp.msu.ru/ )

... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...

254. Психология XX столетия: итоги. Ресурсы

255. http://savenkov.lvk.cs.msu.su/mc/lect01.pdf