... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
... October 9, 1997 . Hale-Bopp and the North American Nebula . ... Explanation: Comet Hale-Bopp 's recent encounter with the inner Solar System allowed many breath-taking pictures. Above, Comet Hale-Bopp was photographed on March 8th in the constellation of Cygnus . ... The North American Nebula is about 1500 light years away, much farther than the comet, which was about 8 light minutes away. ... About APOD > . ...
... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Приветствуем Вас в среде дистанционного обучения Moodle . ... МГУ имени М.В.Ломоносова! ... Инструкция по регистрации и записи на курсы Страница Пропустить доступные курсы . Базовый годовой курс для слушателей программ ?Преподаватель? и ?Преподаватель высшей школы? Обучение ведется в очной и дистанционной форме. ... Teacher: Новикова Галина Викторовна . ... Teacher: Хангельдиева Ирина Георгиевна . ... Курс для магистрантов ФПО 1-го года обучения. ... Курс для магистрантов ФПО . ...
... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...
... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...
. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.
... Electronic journal Issue 4. 10 september 2004 Bonham G.M., Surin A. IP Videoconferencing in Graduate Professional Education: Collaborative Learning for Public Management Introduction. ... While technology offers a range of opportunities that a standard «chalk and talk» class could never match, questions about the educational value of the new digital media loom large. ... If so, how can technology more effectively promote student-centered learning? ... Collaborative IP Videoconferencing. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf -- 94.8 Кб -- 06.07.2014 Похожие документы
... Master Education . ... Master programs . ... objects, development and application of advanced mathematical methods and software to address problems in science, technology, economics and management.The Mathematics and Information Technology for Economic Activity Master ?s programme aims to prepare professionals in economics and finance ... This program aims to prepare high-qualified professionals for the commercial and government organizations in economics and the finance, including: . ...
... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...
Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...
[
Текст
]
Ссылки http://iconolat16.phys.msu.ru/download/icono-lat-2016-fcp-reduced.pdf -- 656.9 Кб -- 29.01.2016 Похожие документы
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...
Вы посетили: inv_engl.html . ... История кафедры . ... Visiting Professor at the University of Oslo, Norway, Oslo, November, 2010 . ... Visiting Professor at the University of Ljubljana, Slovenia, August, June 2010 . ... Visiting Professor at the University of Patras and the University of Athens, Greece, June-July 2009 . ... Visiting Professor at the University of Stockholm, Sweden, January ? ... staff/guterman/inv_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...
Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...
... Запись в библиотеку . ... Книги . ... История МГУ: библиография . ... В каталоге отражены отечественные газеты с 2013 года по настоящее время, хранящиеся в отделах Научной библиотеки. ... Картотека включает описания материалов (с 2005 г.) по истории МГУ имени М.В. Ломоносова. ... Научная библиотека МГУ имени М.В. Ломоносова (НБ МГУ) - обособленное подразделение в структуре университета, действует на основании Положения о библиотеке . ... 2016 Научная библиотека МГУ имени М.В. Ломоносова (НБ МГУ)ї . ...