... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>6) - ccoe.msu.ru/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• INTAS 95-525 Project Main Page
• Department of the Composites Mechanics

Guide to Market Research and Analysis Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4013 Summary Successful businesses have extensive knowledge about their customers and their competitors. ... Market Analysis Who is your customer? ... Product or service focus must be the customer. ... The information will assist in determining business size (output requirements), distribution channels, pricing, promotion strategy and other marketing decisions. ...

Еще в разделе: (Показать все результаты (>30) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 29/09/2015 . ... Natural resousces management? The purpose of the "Natural resources management" Master?s Degree programme is to educate specialists in the field of natural resource management, environmental management, sustainable development of regions and densely urbanized territories. ...

Еще в разделе: (Показать все результаты (>3) - www.hsib.msu.ru/ )

• Master Degree in Chemistry | Высшая школа инновационного бизнеса МГУ

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>2) - phys.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

... mechanic . ... engineer . ... senior researcher . ... 77 (floor -1) . ... Fedoseev Anatoly Ivanovich . docent . ... spekl@phys.msu.ru . ... Hlystov Vladimir Ivanovich . ... Ivanov Sergey Nikolaevich . leading engineer . 939-31-69 . sni@opts.phys.msu.ru . ... iak@opts.phys.msu.ru . ... Kolobanov Vitaly Nikolaevich . ... 2-07 (SINP MSU) . ... korolenko@optics.npi.msu.su . ... junior researcher . ... researcher . ... researcher (SINP MSU) . ... 71 (floor -1), 4-13(SINP MSU) . ...

Еще в разделе: (Показать все результаты (>2) - opts.phys.msu.ru/ )

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...

Еще в разделе: (Показать все результаты (>12) - io.cs.msu.ru/ )

• Abstracts - ORM 2007
• Accommodation - ORM 2007
• Contacts - ORM 2007

KEYWORDS: language evolution, mathematical modelling, branching processes . ... 2 Basic assumptions. ... Dying out, giving birth, and preserving of sign's meanings. ... Modelling of language evolution should be based on some assumptions concerning its micro-level, i.e. level of its micro-units' development. ... That is why it has become the starting point in the building of the mathematical model for the development in time and synchronic correlation of the whole system of a sign's features. ...

Еще в разделе: (Показать все результаты (>67) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization
• MSU - Laboratory for General and Computational Lexicology and Lexicography
• MSU-LGCLL:: Curriculum Vitae of Anatoliy Anatolyevich Polikarpov

. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.

Еще в разделе: (Показать все результаты (>4) - lhe.sinp.msu.ru/ )

• Information for our Guests
• L.Gladilin's address Page

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>2) - tukachev.flogiston.ru/ )