... Ключевые слова: антропология, Отечественная война 1812 года, офицеры, дворяне, обобщенный портрет, Военная галерея Зимнего дворца . ... Для установления направления этнотерриториальных различий от-дельных признаков использовались нормированные разности Zi = (Mi - Mo)/S средних арифмети-чеѓских величин основных антропометрических признаков в разных сериях данных (Mi) от значе-ний московской выборки (Mo). ... Бурлак С.А. Время появления звучащей речи по данным антропологии (с. 110) . ...
... You must have cookies enabled to log in to MediaWiki. ... Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:UserLogin " . Special page . 93.180.27.85 . Talk for this IP address . Log in . ... 1-й семестр 2015 г. Материалы по системе ejudge . ... Special pages . ... About MediaWiki . ...
SHEVELKOV’S GROUP . ... Professor . ... M.S. 1982 . ... Doctoral student . ... Doctoral student (jointly with Dresden TU – prof. Yu. ... Dr. Evgeny V. Dikarev, associate professor (University at Albany, SUNY, USA) . Dr. Mikhail M. Shatruk, assistant professor (Florida State University, USA) . Dr. Marat Mustiakimov, post-doc (University of Bologna, Italy) . ... Dr. Kirill A. Kovnir, post-doc (Florida State University, USA) . ... Dr. Julia V. Zaikina, post-doc (Florida State University, USA) . ...
Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... ICES Journal of Marine Science: Journal du Conseil . ... Immunological Reviews . ... Industrial & Engineering Chemistry Research . ... International Journal of Impotence Research . ... International Journal of Management Reviews . ... International Journal of Public Opinion Research . ... International Journal of Urban and Regional Research . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...
... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf -- 233.1 Кб -- 06.07.2014 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Combating terrorist use of the Internet / Comprehensively Enhancing Cyber security - The OSCE experience Remarks by Nemanja Malisevic Asst. ... OSCE Mandate for combating terrorist use of the Internet What is the OSCE mandate for combating terrorist use of the Internet and enhancing cyber security? ... Because there is only one cyberspace. ... First of all, let me emphasise that combating terrorist use of the Internet and enhancing cyber security will remain an area of focus for the OSCE and the ATU. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc -- 213.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/malisevic.doc -- 213.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc -- 213.0 Кб -- 02.04.2012 Похожие документы
Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...
LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ TSUNAMIGENIC POTENTIAL OF SUBMARINE EARTHQUAKES IN DIFFERENT REGIONS IN THE PACIFIC Viacheslav K. Gusiakov Institute of Computational Mathematics and Mathematical Geophysics, Siberian Division, Russian Academy of ... Fig. 1 shows the positions of 10 main tsunamigenic regions in the Pacific. ...
30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf -- 136.8 Кб -- 19.03.2008 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
Sites . ... By submitting this form, you are alerting the Google Sites team that this site has content that is in violation of our Terms of Use . If you own the copyright to content on this Site and would like it removed, please see our instructions for notification of copyright infringement . ... This Site contains spam. This Site contains phishing. ... This Site promotes violence or has hate speech. ... This Site contains content that otherwise violates Google Sites Terms of Use . ...
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ... Agricultural and Biological Sciences ...
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы