... The integrals were used as structural descriptors. ... Results of classification analysis using descriptors generated from the data of C NMR , elemental analysis and SEC Data Linear Discriminant Analysis K nearest neighbours Classification of Descriptors * Classification of Descriptors * test samples, % test samples, % 13 C NMR 62 CHX , CH3O , COO , 67 CHn, CH3O , CARX, CAR, CH2X, C=O CHX , CARX, COO 13 C NMR 68 CHX , Mw, CARX, ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2006/konstantinov-classification.pdf -- 54.9 Кб -- 14.09.2006
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2006/konstantinov-classification.pdf -- 54.9 Кб -- 14.09.2006 Похожие документы
... Newsgroups: sci.astro,sci.space.tech,sci.space.science,sci.space.shuttle,sci.answers,news.answers . Subject: Astro/Space Frequently Seen Acronyms . ... Acronym List for Space and Astronomy . ... Note that this is intended to be a reference for frequently seen acronyms, and is most emphatically not encyclopedic. ... Anglo-Australian Observatory . ... Astronomical Image Processing System . ... American National Standards Institute . ... Data Relay Satellite . ... List of Frequently Seen Acronyms (!) ...
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
Кафедра истории зарубежной литературы . ... Педагогическая задача кафедры ? ... Выпускники кафедры преподают историю западных литератур, сравнительную историю западной и русской литературы в МГУ, других московских, российских, зарубежных университетах, а также работают в институтах РАН РФ, в ведущих библиотеках, редакциях ?бумажных? и электронных СМИ, востребованы как переводчики художественной литературы, нон-фикшн. ... Кафедра истории зарубежной литературы филологического факультета МГУ . ...
Кафедра . ... Новости . 2016 . ... Заседание кафедры молекулярной биологии состоится 6 апреля в 11.00 в 336 к. 2016 . ... Группа российских ученых при участии исследователей из МГУ имени М.В.Ломоносова выяснила, что испытываемый клетками кратковременный тепловой стресс приводит к индукции клеточного старения. ... Молекулярная биология опирается на содружество трех наук ? биологии, физики и химии. ... 2016 Кафедра молекулярной биологии . Биологического факультета МГУ им. М.В. Ломоносова . ...
ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013 Похожие документы
... Main practical applications of X-rays lie in the important for the society fields of medical imaging, custom, transport inspection and security. Scientific applications besides of fundamental research include material sciences, biomicroscopy, and protein crystallography. ... The first are relatively cheap, robust, and compact but have low brightness and poorly controlled photon spectrum. ... So accelerator based X- ray sources are mainly still used for scientific applications and X-ray tubes ? ...
... Graduated from M.Lomonosov Moscow State University, Department of Mechanics and Mathematics. Dissertation's title of Ph.D. (Phys.& Math): "Aerodynamic Characteristics, Shape-Formation and Stressed-Strained State of Parachute Canopy." ... Graduated from M.Lomonosov Moscow State University, Piano Class. ... Development of mathematical models and parameter computation methods for the shape, aerodynamic drag and stressed-strained state of parachutes with different canopy geometry. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...
... However, our studies show that Prosilica EC650 has very good p erformance to use as DIMM image detector. ... The sub-directories /opt/dimm/data/out for the output data file, /opt/dimm/data/log for the output log file yymmdd-dimm.log and /opt/dimm/etc for the configuration file must b e created. ... Pictures mode The Pictures mode provides grabbing of the star b ox images and storing their sequence as one output file "b oxrecord.fits" in /opt/dimm/data/images/ sub directory. ...
[
Текст
]
Ссылки http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf -- 219.2 Кб -- 23.03.2008 Похожие документы
... Moscow State University Russian Language Centre . ... The University of Nebraska-Lincoln Russian Club and the Department of Modern Languages and Literatures hosted Russian Night, the last event of Russian Week, at the UNL Culture Center. (more.. ... The international scientific conference " The Humanity and the environment " was held on 26-28 October, at the Moscow М.В. Lomonosov State University.The Conference was organized in partnership with State university of New York (SUNY). (more.. ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf -- 202.5 Кб -- 26.08.2013 Похожие документы
... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...
THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The laboratory of chemistry and physics of sensor and semiconductor materials is the largest laboratory of Inorganic chemistry department , Lomonosov Moscow State University. The laboratory staff include 21 members and there are 25 students and postgraduate students of Chemistry Faculty , Physics Faculty and Faculty of Materials Science . ... semiconductor materials for sensors . ... Phone: +7(495) 939 54 71 . ...
... Institute of Nuclear Physics, . ... I have been directly involved in theoretical and phenomenological analysis -- within the D? collaboration -- devoted to a search for single top quark production in the electroweak processes. ... 1] B. Abbott et al. ... D0 Collaboration], ``Inclusive jet production in p anti-p collisions,'' hep-ex/0011036. ... D0 Collaboration], ``Search for electroweak production of single top quarks in p anti-p collisions,'' hep-ex/0008024. ... Phys.Rev.Lett. ...