THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...
... However, derivation of its main equations from the free energy of a superconductor was only briefly described in the original paper [3], and some basic points of this procedure are still not completely understood. ... What is the sense of the free energy variation with respect to the vector potential of the magnetic field? ... Indeed, in practical calculations the GinzburgLandau equations are often used in combination with the GinzburgLandau free energy of the superconductor. ...
НЕЙРОСЕТЕВЫЕ МЕХАНИЗМЫ КОГНИТИВНОЙ ГИБКОСТИ А.Т. Терехин, Е.В. Будилова, М.П. Карпенко, Л.М. Качалова, Е.В. Чмыхова 1. ... Когнитивная гибкость нейронной сети определяется как актуальный диапазон изменения гладкости ее функции Ляпунова - большая гладкость облегчает нахождение стратегически эффективных направлений решения задачи, а меньшая необходима для проработки его деталей. ... При неизменных синаптических весах увеличение параметра гладкости приводит к увеличению гладкости функции энергии сети. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Rostov_Varifoc.doc -- 2025.0 Кб -- 09.06.2009 Похожие документы
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
... Unemployment of graduates combined with a shortage of highly educated young people is putting the European governments under pressure to act. ... The Bologna Declaration explicitly mentions the lack of competitiveness of European Higher Education institutions. The signatory countries actually explicitly express their goal to "ensure that the European higher education system acquires a world- wide degree of attractiveness equal to [Europe's] extraordinary cultural and scientific traditions". ...
... C. Gibbons, M. Locke: Cupid and Death - Third Entry . К. Гиббонс, М. Локк: Купидон и Смерть - Явление третье . Second Entry . ... Fourth Entry >> . ... Third Entry . ... Enter Chamberlain . Входит Прикащик . The Scene Chamberlain . ... Сцена Прикащик . ... Enter Host . ... Host . ... Chamberlain . ... Настоящий перевод текста маски Гиббонса и Локка Купидон и Смерть публикуется на условиях лицензии Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Непортированная . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
... Current results . Scientific results . ... Microorganism and fungi . ... The microorganisms catalyze important changes in the biosphere, represent the source of the main atmosphere components and responsible for a significant part of the genetic diversity on our planet. ... That?s why the planned work will be an important factor in solving the fundamental problems in biology of microorganisms, while the results will become the basis for the development of new effective biotechnologies. ...
... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Discrete mechanics: a kinematics for a particular case of causal sets arXiv:1008.5169v1 [gr-qc] 30 Aug 2010 Alexey L. Krugly Abstract The mo del is a particular case of causal set. ... There are two elementary pro cesses. ... These two elementary pro cesses are called monads [13]. ... Consider the set G of monads and a binary relation (an immediate causal priority) over this set. ... Pro of: Two monads are connected by an immediate causal priority if they are included in the same edge or x-structure. ...
... Пояснение: Солнечные пятна - магниты размером с Землю - мы обычно видим как плоские образования на поверхности Солнца. Однако эта картина превращений солнечного пятна показывает, как оно выглядит на разных высотах, что позволяет представить его в трех измерениях. ... Изображения в середине последовательности показывают Солнце в свете, который в основном излучается на высоте в несколько сотен километров над фотосферой . ...
... Семинары . ... UNИX . ... Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ... Участие в семинаре. ...
... Рощин Алексей/ Roshchin Alexei, 2 курс, Public sector of the Russian economy in the post-Soviet period/ Государственный сектор экономики России в пост-советский период. ... Венгеров Максим, 2 курс, Education in Africa. ... Мария Лагузова, 2 курс, The problem of Internet and Social networks in the modern World. ... Красильникова Анастасия, 2 курс, Political technologies at the elections in the 1990s in Russia/ Политтехнологии избирательных кампаний 90-х годов в России. 12.15-13.00 - перерыв 1. ...
... Сильные мира free software и open source . ... Очень рекомендую читать оригиналы на английском, потому как особый "вкус текста" неизбежно теряется, даже если (редко когда) перевод хороший: . Что такое свободное ПО (оригинал) (перевод) . Введение в предмет, определение философии свободного программного обеспечения. ... Двадцать лет свободному ПО: Что дальше? (оригинал) (перевод) . ... GNU . ... Знаменитый GNU Manifesto, множество текстов о природе свободного ПО и свободы людей вообще. ...
BIRD SPECIES DATABASE . of the Arctic Birds Breeding Conditions Survey . ... Queries . View list of species . ... Get list of species, for which data are available by pushing "Query" button below "View list of species" invitation. Latin name of a species can be copied from the list to the "Species name" field or typed-in there (but exactly as it appears in the species list). ... Query results will be tabulated in the window below the map, and can be browsed through or copied. ...
... 26, No. 9, 791799 doi:10.1006/cbir.2002.0946, available online at http://www.idealibrary.com on CENTROSOME -DEPENDENT ANISOTROPIC RANDOM WALK OF CYTOPLASMIC VESICLES IVAN V. MALY* and IVAN A. VOROBJEV Laboratory of Cell Motility, A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow 119899, Russia Received 27 September 2001; accepted 28 June 2002 We approach the problem of an apparently random movement of small cytoplasmic ... 1997; Bray, 2001). ... 1997). ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/vorobjev2002CBI.pdf -- 502.5 Кб -- 07.10.2002 Похожие документы
... Ershov 7 Ilia A. Dementiev Spectrophotometric kinetic study and analytical implications of the glucose oxidase-catalyzed reduction of [M III (LL) 2Cl2 ] c complexes by D-glucose (MpOs and Ru, LLp2,2b-bipyridine and 1,10-phenanthroline type ligands) Received: 1 July 1998 / Accepted: 13 January 1999 Abstract Glucose oxidase-catalyzed reduction of cis[M III (LL) 2Cl2 ] c (MpOs and Ru) complexes to cis[M II (LL) ... A common feature for Os III and RFc c is a surfactant effect. ...