A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...
... The sixth book "The Poetry of Moscow University: from Lomonosov and up to…" . has been published. The Poetry of Moscow University: from Lomonosov and up to… " . ... The idea of the project is to collect verses of all the poets who studied or worked in Moscow University. ... The greatest part of the works hasn’t been republished since they first appeared at the end of the 18 th , 19 th or the beginning of the 20 th century. ... In November 2005 the first printed book of poetry was published. ...
... Research . ... Welcome to the website of the Laboratory of Chemical Thermodynamics of Lomonosov Moscow State University! ... Prof. Gennady F. Voronin . ... The laboratory wasљestablished by Prof. Adam V. Rakovsky first as a "halurgy laboratory" in 1930. Later in 1934, itљwasљrenamed "Laboratory of Chemical Thermodynamics". ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...
... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...
... TUS . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... Modi?ed KLYPVE is a novel ?uorescence detector of ultra high energy cosmic rays (UHECRs, energies 50EeV) to be installed on the Russian Segment of the International Space Station. ... Two types of orbital detectors of extreme energy cosmic rays are being developed nowadays: (i) TUS and KLYPVE with reflecting optical systems (mirrors) and (ii) JEM-EUSO with high- transmittance Fresnel lenses. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...
. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.
Magnetism Department MSU . ... Education . ... Process of education on magnetism division . ... Different courses on classical theory of magnetic phenomena and on actual problems of modern theory of magnetism are read on magnetism division. ... Students of magnetism division do practical work on the 8th term with more then 50 students from other divisions each year. ... Physics of semiconductors division . ... oblig. – alt. ... Alexander Shaligin, associate prof. assessment . ... oblig. 519, 505 . ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
... Hello everybody out there using minix - I'm doing a (free) operating system (just a hobby, won't be big and professional like gnu) for 386(486) AT clones. ... I'd like any feedback on things people like/dislike in minix, as my OS resembles it somewhat (same physical layout of the file-system (due to practical reasons) among other things). ... This implies that I'll get something practical within a few months, and I'd like to know what features most people would want. ...
SKOBELTSYN INSTITUTE OF NUCLEAR PHYSICS (SINP) A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION MAGNET FOR 55 MeV RACE TRACK MICROTRON MSU-SINP Preprint No 2011-2/866 1 UDC 621.039 A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov E-mail addresses: shved@depni.sinp.msu.ru DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION ... Magnetic screen system optimization.. ...
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...
... Font: Times New Roman . ... size - А4 (21 cm х 29,7 cm) . ... Title should be typed in capital letters, Times New Roman, size 13, boldface font; formatting: center. ... The title and the number of the table should be center-formatted (Times New Roman, size 11, single-spaced, no period/full stop at the end of the title). ... The title under the illustration should be center-formatted (Times New Roman, size 11, single-spaced, no period/full stop at the end of the title). ... Use Times New Roman size...
... International Olympiad БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ...
... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...
... психологи . ... Флогистон / kluver . ... Сайт: http://www.kluver.ru/ . ... Годы учебы: 2002 - 2008 Сферы профессиональной деятельности: психологическая диагностика (личностная профориентационная патопсихологическая нейропсихологическая и т. п.) первичное консультирование Опыт работы: медицинский психолог . ... Февраль 2009 - продолжаю работать . психолог . ... 0 2008 - продолжаю работать . ... Проведение индивидуальных консультаций с подопечными Центра (в основном с пенсионерами) и сотрудниками. ...