... THE LJUBLJANA SUMMER SCHOOL 2006 . ... THE LJUBLJANA SUMMER SCHOOL 2006 is a new intensive programme open to both undergraduate and graduate students of Business, Economics, and other fields of Social Sciences. The programme was created at the Faculty of Economics in Ljubljana in order to impart knowledge by taking full advantage of our country s unique geographical position: the meeting point of East and West. ... The Summer School s aim is to learn by applying knowledge to real-life situations. ...

Еще в разделе: (Показать все результаты (>55) - www.mgubs.ru/ )

Dynamo Theory and Earth's Magnetic Field Paul Demorest May 21, 2001 1 Intro duction The Earth's magnetic field belongs in that class of physical phenomena which are commonplace yet also very complex. ... 3 Single Disc Dynamo Before we dive into the mess of equations and approximations that describe how fluid motion and magnetic field interact, it is useful to demonstrate a very simple system which exhibits dynamo action. ... A system without fluid motion cannot support a magnetic field indefinitely. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf

ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 20:10:47 Mon, 20 Dec 2010 05:32:56 GMT Peter Zotov <whitequark@тАж> [22:be41e64e5dd2] * tanchiki/game.py (modified) Make game field centered on (0,0). Mon, 20 Dec 2010 05:15:19 GMT Peter Zotov <whitequark@тАж> [21:fe5df803d6c2] * tanchiki/body.py (modified) * tanchiki/controller.py (added) * tanchiki/game.py (modified) * tanchiki/user_controller.py (added) Split UserController and Controller classes. ...

Еще в разделе: (Показать все результаты (>388) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/tanchiki/log/tanchiki?format=changelog&rev=21%3Afe5df803d6c2&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/tanchiki/log/?format=changelog&rev=fe5df803d6c21eb31091fd830aa22aa31fc1b103&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/tanchiki/log/tanchiki?format=changelog&rev=be41e64e5dd23f0a73a4c3728638b3d74a0151d6&limit=100&mode=stop_on_copy

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

компьютерные курсы . курсы . ... компьютерных . ... Microsoft . ... IBM . ... Подготовительные курсы || обучение студентов || олимпиады || проекты . ... курсы Microsoft || курсы Oracle || курсы IBM || . ... НОУ "УНИВЕРСИТЕТСКАЯ МАТЕМАТИЧЕСКАЯ ШКОЛА", 1995-2016 . ...

Еще в разделе: (Показать все результаты (>3) - www.fizmatclass.ru/ )

• Курсы Microsoft. НОУ Университетская Математическая Школа

... 000, 1­12 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...

Еще в разделе: (Показать все результаты (>2) - kcor.sai.msu.ru/ )

• http://kcor.sai.msu.ru/arXiv1102.1159.pdf

... Aerospace and environmental medicine Automation and Remote Control Optoelectronics, Instrumentation and Data Processing Acoustical Physics St Petersburg Mathematical Journal Algebra and Logic Angiologiia i sosudistaia khirurgiia = Angiology and vascular surgery Anesteziologiya i Reanimatologiya Antibiotiki ... Moscow University Mathematics Bulletin . ... Moscow University Chemistry Bulletin . ... Mathematics - , . ... Physics, Chemistry, Mathematics Nauchno-Tekhnicheskaya Informatsiya. ...

Еще в разделе: (Показать все результаты (>3) - geol.msu.ru/ )

• http://www.geol.msu.ru/obsh/uch_ch2.doc

... Department of Vertebrate Zoology . PhotoGallery 'Field Practice at the White Sea' . The White Sea Biological Station is located on the very coast of Kandalaksha Bay of the White Sea. ... The Vertebrate Zoology course with Dr. Sergei V. Ogurtsov (assoc. prof. of the Department of Vertebrate Zoology) describes the biodiversity and the variety of ecological groups of vertebrates of the White Sea region through the methods of species recognition by songs, tracks, fecal pellets etc. ...

Еще в разделе: (Показать все результаты (>33) - vertebrata.bio.msu.ru/ )

• Courses
• Анализ данных в биологических исследованиях
• Department of Vertebrate Zoology

... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...

Еще в разделе: (Показать все результаты (>10) - www.biophys.msu.ru/ )

• Technical Specifications
• Устинин Дмитрий Михайлович

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2068.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . ... Select Type . ... Ref . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Config.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>25) - osk.msu.ru/ )

• http://osk.msu.ru/forum/members/adollekautoto.2142/?_debug=1
• http://osk.msu.ru/forum/members/arbimeorirm.2192/?_debug=1
• http://osk.msu.ru/forum/members/catyfopwbex.2168/?_debug=1

... BMC Genomics 2013, 14:745 http://www.biomedcentral.com/1471-2164/14/745 DATABASE Open Access RegPrecise 3.0 ­ A resource for genome-scale exploration of transcriptional regulation in bacteria Pavel S Novichkov1*, Alexey E Kazakov1, Dmitry A Ravcheev2,3, Semen A Leyn2, Galina Y Kovaleva1,2, Roman ... Inna Dubchak1 and Dmitry A Rodionov 2,3* Abstract Background: Genome-scale prediction of gene regulation and reconstruction of transcriptional ... Figure 5 The regulog page in RegPrecise. ...

Еще в разделе: (Показать все результаты (>11) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/jbcb_2006.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf

ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...

Еще в разделе: (Показать все результаты (>17) - www.sai.msu.ru/ )

• Digitization of Moscow Plate Archives
• Moscow Astronomical Plate Archives: Contents, Digitization, Current and

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• ConClus

. Fatal error : Can't use method return value in write context in /webs/cacs/system/application/modules/changepass/controllers/changepass.php on line 17 .

278. User's guide

279. SAI OCL Catalog Virtual Observatory

280. Uneex . SeminarCorporateLDAP