... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...
Combating terrorist use of the Internet / Comprehensively Enhancing Cyber security - The OSCE experience Remarks by Nemanja Malisevic Asst. ... OSCE Mandate for combating terrorist use of the Internet What is the OSCE mandate for combating terrorist use of the Internet and enhancing cyber security? ... Because there is only one cyberspace. ... First of all, let me emphasise that combating terrorist use of the Internet and enhancing cyber security will remain an area of focus for the OSCE and the ATU. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc -- 213.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/malisevic.doc -- 213.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc -- 213.0 Кб -- 02.04.2012 Похожие документы
МГУ имени М.В.Ломоносова Русская версия . ... Bioengineering and Bioinformatics . ... 29 Feb 2016 . ... Russia, Moscow . ... Chairman: Skulachev VP (Dean of the Faculty of Bioengineering and Bioinformatics, Moscow State University); . E xecutive secretary: AV Golovin (Assistant Professor, Department of Bioengineering and Bioinformatics, Moscow State University); . ... 119234, Moscow, GSP-1, Lenin Hills, Moscow State University 1, page 73, Faculty of Bioengineering and Bioinformatics, room 433. ...
Самсонов В.А., Шамолин М.В. К задаче о движении тела в сопротивляющейся среде // Вестн. ... Шамолин М.В. Определение относительной грубости и двупараметрическое семейство фазовых портретов в динамике твердого тела // Успехи матем. наук. ... Шамолин М.В. Случаи интегрируемости уравнений движения четырехмерного твердого тела в неконсервативном поле сил // 'Современные проблемы математики, механики и их приложений'. ... Шамолин М.В. Движение твердого тела в сопротивляющейся среде // Матем. моделирование. ...
... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/febsz.pdf -- 49.2 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/febs1998.pdf -- 49.2 Кб -- 18.02.2008 Похожие документы
Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...
... Гордов Е.П., Кабанов М.В., Лыкосов В.Н.. ... Гордов Е.П., Лыкосов В.Н., Крупчатников В.Н., Окладников И.Г., Титов А.Г., Шульгина Т.М. (Институт мониторинга климатических и экологических систем СО РАН и Томский госуниверситет, gordov@scert.ru; НИВЦ МГУ и ИВМ РАН; СибНИГМИ), "РАЗРАБОТКА ПРОГРАММНО-АППАРАТНОЙ ПЛАТФОРМЫ, ОБЕСПЕЧИВАЮЩЕЙ ФУНКЦИОНИРОВАНИЕ WEB-ОРИЕНТИРОВАННОГО ПРОИЗВОДСТВЕННО-ИССЛЕДОВАТЕЛЬСКОГО ЦЕНТРА В ОДНОЙ ИЛИ НЕСКОЛЬКИХ КОНКРЕТНЫХ ПРИКЛАДНЫХ ОБЛАСТЯХ НАУК ОБ ОКРУЖАЮЩЕЙ СРЕДЕ". ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15614 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Наследие Востока . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Kraftwerk . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...
... Администрация Химического факультета МГУ . ... Научный отдел Химического факультета МГУ создан в 1963г.. Деканом Химического факультета в те годы был профессор И.Ф. Луценко, а его заместителем по научной работе - профессор Ю.В.Филиппов. Курировали работу научного отдела со дня его основания заместители декана по научной работе - выдающиеся ученые факультета: В.М. Татевский, И.Ф. Луценко, Ю.В. Филиппов, Ю.Я. Кузяков, М.Я. Мельников, Б.А. Поповкин, О.А. Петрий, А.В. Анисимов. ... Отдел кадров . ...
... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... Building on the objectives of your current business plan, you schedule a comprehensive series of promotional activities for your company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...
... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... О кафедре . Кафедра суперкомпьютеров и квантовой информатики . ... Кафедра проводит обучение по образовательной программе шестилетней интегрированной подготовки высококвалифицированных специалистов с последовательным освоением образовательной программы бакалавриата (4 года) по профилю ?Системное программирование и компьютерные науки? и образовательной программы магистратуры (2 года) по двум магистерским программам: ?Суперкомпьютерные системы и приложения? и ?Квантовая информатика?. ... ИПМ РАН . ...
... MTEL-2/RELEC (Telescope T) Instrument: Data Format Current Status . ... BE KNA RELEC . ... PSA-SAS3-Relec instrument, data format current status . ... Radio frequency waves diagnostic on RELEC satellite . ... First results ultraviolet and infrared radiation detector testing on board of the RELEC microsatellite . ...
. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
О лаборатории . ... Лаборатория теоретической биофизики . ... Here the guide to use RESP technique based on calculations from Firefly or GAMESS-US is presented. ... Note, that RESP algorythm will fit potential in the set of points which are selected according to $PDC group in the input-file. ... Нет комментариев " Using RESP with GAMESS-US and Firefly (PC-GAMESS) " . ... Using Firefly/GAMESS-US efficiently . ... Scannin? in Using Firefly/GAMESS-US efficiently? 2012 ERG Research Group . ...
... The Department of Operations Research . ... Coordinators Contacts . ... on Operations Research, . ... Moscow, April 10-14, 2007 Coordinators . ... 1) New models and methods . Prof. V.V. Morozov . ... 3) Multiple objective decision making . ... Prof. I.G. Pospelov, Prof. A.A. Shananin . ... Prof. A.A. Belolipetckiy . ... 9) Game-theoretic models . ... Symposium A: Analysis of the markets and decision making in electric power industry . ... Symposium B: Models of political decision making. ...