Lomonosov Moscow State University Biological faculty Botanical garden (Russia) (http://botsad.msu.ru/eng_news.htm) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The second information message Dear colleagues! ... Educational and enlightening activities based on collections of genus Iris L. The program of the Symposium will consist of plenary and sectional sessions as well as poster presentations. ...
[
Текст
]
Ссылки http://www.botsad.msu.ru/docs/eng_iris2.doc -- 901.5 Кб -- 24.02.2011
[
Текст
]
Ссылки http://botsad.msu.ru/docs/eng_iris2.doc -- 901.5 Кб -- 24.02.2011 Похожие документы
... Сайт МГУ . ... Дистанционные олимпиады Факультета иностранных языков и регионоведения Интервью заместителя декана по информационно-образовательным технологиям Назаренко Аллы Леонидовны. фото дня Фоторепортаж с "Дня первокурсника" . ... Центр дистанционного образования МГУ имени М.В.Ломоносова предлагает школьным учителям обучение по следующим программам повышения квалификации: . ... Добавлена информация о дистанционной программе MBA Экономического факультета МГУ . ... и непрерывного образования МГУ,...
. Uneex . MailingList . Printable . Новости . О нас . Семинары . Лекции . Рассылка . Контакты . Рассылка предназначена для обсуждения семинара, прошедших и планирующихся докладов, а также любых тем, связанных с UNИX. Относитесь к собеседникам с уважением -- и они ответят вам тем же. Все сразу. https://imap.cs.msu.su/mailman/listinfo/uneex . Copyright 2003 by the contributing authors. All material on this site is the property of the contributing authors. Send feedback to svv at cmc dot msu dot ru.
... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...
... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
Biophysics, Vol. ... CELL BIOPHYSICS Kinetic Model of Primary Photosynthetic Processes in Chloroplasts. Description of the Fast Phase of Chlorophyll Fluorescence Induction under Different Light Intensities G. V. Lebedeva-, N. E. Belyaeva", O. V. Demin-, G. Yu. ... In the framework of the model, we present a description of the fast phase of chlorophyll fluorescence induction as dependent on the kinetics of the main primary steps of photosynthesis in a broad range of illumination intensity. ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
The Early Music Theatre >> Repertoire >> The Prophetess.. The Prophetess (The History of Dioclesian) is a masterpiece of the English Restoration opera. ... There is little good to say about most late Roman emperors. ... Muscovites know very well a Roman officer who suffered because of his religious beliefs under Dioclesian: the future martyr Saint George the Winner.) ... You shouldn't joke", the prophetess responded, "because you will become an emperor, Dioclus, when you kill Aprus". ...
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
Conference . ... 3rd Announcement . 2nd Announcement . ... The 2006 autumn IVOA Interoperability Meeting and Small Project Meeting will be held in Moscow, Russia, from September 18-22. The venue for the meeting are Institute of Astronomy, Sternberg Astronomical Institute and Headquarter of the Russian Academy of Sciences. ... Working Groups: VOTable, UCDs, Registry, Data Models, Data Access Layer, VO Query Language, Grid and Web Services, and VOEvent. Interest Groups: Applications, Theory. ...
ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...
... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . История ГАИШ и Московской обсерватории . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... Welcome to the Extra-galactic research group of SAI ! ... Sternberg Astronomical Institute is older than the entire field of extra-galactic astronomy. ... At the same time, the Extra-galactic astronomy group as an element of the institute structure remains the youngest subdivision of SAI. ... 2007, astro-ph/0709.3047 . ...
A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2001_RadialMaze.doc -- 28.0 Кб -- 16.03.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...