Отчетный год 2009 механико-математический факультет Приложение 1 к таблицам 2-2 и 2-3 Сведения о монографиях, главах в монографиях, учебниках, учебных пособиях и научно-популярных книгах представляется в Управление научной политики и организации научных исследований только в электронном виде по адресу: unir@rector.msu.ru |? ... 1 |Ахметов |Численное |мон | ... 500 |19 |М.: МГУ | ... Ю.Г., |состояний мягких | ... 26 |М.: МЦНМО | ... 222 с|Cambridge | ... Equations. ... й А.М. |представителей в | ...
[
Текст
]
Ссылки http://scidep.math.msu.su/Sites/demosite1/Uploads/monogr_09.docs1.doc -- 53.5 Кб -- 03.03.2011 Похожие документы
... Тема кандидатской диссертации - 'Поле вековой вариации и его свойства' (специальность: Геофизика). ... Рассмотрены условия замагничивания джетов [1]. 1992 г. - совместно с Д.Д.Соколовым и А.М.Шукуровым исследованы условия устойчивости магнитного поля в галактическом диске [2]. 1992-1995гг. - изучены корреляционные свойства поля вековой вариации на поверхности Земли. ... Решетняк М.Ю. Корреляционные свойства поля вековой вариации. ... Решетняк М.Ю. О миграции фокусов вековой вариации. ...
Кафедра общей топологии и геометрии . ... Публикации . ... Сипачева О.В. , The Topology of Free Topological Groups, Journal of Mathematical Sciences, vol. 131, no. 4, 2005, pp. ... Сипачева О.В. , Топология свободной топологической группы, Общая топология и топологическая алгебра. ... Резниченко Е.А. , Сипачева О.В. , The Fr\'echet--Urysohn and $\alpha_2$-properties in separable spaces, groups, and locally convex spaces, 13th Summer Conf. on General Topology and Its Applications, Mexico, 1998, pp.~ ...
Молекулярная динамика . Расчетные методы симуляции молекулярной динамики базируются на представлениях классической механики, движение атомов описывается в формализме уравнений Ньютона для системы N взаимодействующих частиц: . Каждый атом считается находящимся в силовом поле, создаваемом другими атомами, сила взаимодействия будет выражаться как производная функции потенциальной энергии. ... Использование уравнений Ньютона автоматически приводит нас к классическому описанию движения атомов. ...
... More Reports . ... Management of bird species that lack sexual dimorphism often faces a problem of sex determination. ... In present study we investigated sexual differences in the loud whistles of white-faced whistling duck. ... The loud whistles were tape-recorded in Moscow Zoo from 9 adult males and 2 females that were individually marked and were held together in outdoor enclosure. ... The male loud whistles were always lower in frequency than female calls. ... Research * Student Reports . ...
МГУ имени М.В.Ломоносова Русская версия . ... Asian and African Studies . Computational Mathematics and Cybernetics . ... Art Criticism and History . History and Art History . Section Mathematics and mechanics . ... Public Relations and Theory of Communication . ... Theory, History and Methodology of Translation . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... Theory and methods of teaching mathematics . ... МГУ имени М.В. Ломоносова . ...
... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address: ed.mos2010@gmail.com . ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...
Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... The specialist programme is a first step to the science in a life of every man. On the morrow of the education, students get a specialist degree and a diploma of higher education in two languages . ... The list of enterance examinations for Mathematics and Mechanics Faculty?s entrants . ... 2016 Mechmath admission for internetional students ...
... Юрий (admin) Новости AMOS , IBM SPSS Statistics , Программа AMOS , Структурное моделирование (SEM) 2 Comments . Поступила в продажу книга Наследов А.Д. IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных 1 издание, 2013 год, 416 стр., 17х23 см (70х100/16), ISBN 978-5-496-00107-6 . Книга представляет собой практическое руководство по анализу данных с помощью самой мощной и популярной программы статистической обработки информации ? IBM SPSS Statistics 20. ...
... Название доклада печатается строчными буквами, начиная с заглавной, 14 кегль, и располагается по центру страницы. Ниже, пропуская одну строку (12 кегль), приводятся инициалы и фамилии авторов (именно в такой последовательности, между инициалами пробел не ставится). На следующей строке приводятся названия организаций, которые представляют авторы (курсивом, 10 кегль). ... Формулы набираются в редакторе формул Microsoft Equation, 12 кеглем - большой символ, и располагаются по центру строки. ...
Speech of Russia Rectors' Union President, Rector of Moscow State Lomonosov University, academician Victor A. Sadovnichiy at the leading higher school institutions of Russia and China Forum "The role of international cooperation in the Higher Education Quality Increase" Dear Mrs. Chen Zhili! ... I have named it "Moscow University - a look into future of education in Russia". ... At the desire of many Chinese rectors, I will tell you about the main scientific breakthroughs of Russian universities. ...
... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...
Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf -- 583.5 Кб -- 21.09.2015 Похожие документы
... Цикл статей «Регулирование активности ДНК-связывающих ферментов» Агапкина Юлия Юрьевна, старший научный сотрудник химического факультета Зацепин Тимофей Сергеевич, научный сотрудник химического факультета 2. статья «Find It If You Can: A Game for Modeling Different Types of Web Search Success Using Interaction Data (Моделирование различных определений ... Цикл статей «Самоаффинные многогранники и аффинные инварианты выпуклых тел. ...
[
Текст
]
Ссылки http://expertise.msu.ru/sites/default/files/2012_deripaska_results.doc -- 151.5 Кб -- 02.01.2013 Похожие документы
The revision of the MASS/DIMM star catalogue N. Shatsky, V. Kornilov March 16, 2008 Abstract The compilation of the (updated) version of the MASS (MASS/DIMM) device target catalogue is described. ... Then the list was cleaned according to following criteria: I. Remove stars too faint for a MASS device. ... Here the color equation of the Sternb erg device was taken: M AS S mag = V mag + 0.45 (B - V ); stars with M AS S mag > 3.2 were removed. ... This was made based on the GCVS4.2 catalogue data. ...
... В качестве сравнительного материала определялся уровень стероидных гормонов в московской выборке (480 человек). ... Проведены две серии экспериментов для определения высотного соотношения между опорными поверхностями элементов рабочего места. ... Серии отличались высотой сиденья. ... Международный симпозиум, посвященный 150-летию парижского антропологического общества, 'От концепций из прошлого к исследованиям в будущем', 26-30 января 2009, Париж (А.П. Бужилова) (стр. ...
... Author: Гаина Алексей . Subject: HISTORY of ASTRONOMY: V.A. ALBITZKY(Russian and English) . ... Nachr., ... 1928, Izvestia GAO Poulkovo, Vol. ... 1941, Izvestia KrAO, vol. ... KrAO, vol. ... 1947, Izvestia KrAO, vol. ... KrAO . ... Subject: 20-летие школы "Квантовые частицы в интенсивных полях" . ... 3 мая исполняется 20 лет со дня открытия в Молдавии школы молодых ученых "Квантовые частицы в интенсивных полях". История школы такова: . ... 4 мая, утро . ... Кууск П. 7 мая, утро . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... Science . ... According to the fact that ecological conflicts has a global scale in international watersheds, transboundary location of Selenga river complicates the problem of scientific resolution of the conflicts between water consumers. ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...