... Информация о Службе . ... Служба содействия трудоустройству ставит перед собой задачу информирования студентов и выпускников о карьерных возможностях в компаниях, заинтересованных в специалистах, получивших образование на нашем факультете, и приглашает к сотрудничеству работодателей. ... Организатор: Служба Содействия Трудоустройству при Экономическом факультете МГУ им. М.В. Ломоносова . ... Чемпионат пройдет 17 апреля 2016 года на Экономическом факультете МГУ им М.В. Ломоносова. ... Опыт работы: . ...
О лаборатории . ... Лаборатория теоретической биофизики . ... Here we provide some instructions that will allow you to make your own visualization using powerful abilities of PyMol. Below you can find step-by-step instruction of how to visualize partial charges or other atomic information. ... Partial charge? All charges will appear near all atoms! ... Нет комментариев " Visualize partial charges in PyMol " . ... Visualize partial charges in PyMol . ... 2014 ERG Research Group . ...
THOMSON ELECTRON X-RAY SOURCE FOR MEDICAL APPLICATIONS E.G. BESSONOV1, R.M. FESHCHENKO1*, M.V. GORBUNKOV1, V.I. SHVEDUNOV2 and A.V. VINOGRADOV1 1 2 P.N. Lebedev Physical Institute, 119991 Russia, Moscow Leninskii Prospect 53 Nuclear Physics Institute of Moscow State University, 119899 Russia, Moscow, Vorobyevy Gory Abstract A source of medical x-rays based on a 50 Mev storage ring and a quasi-continues picosecond laser is considered. ... Then the storage ring emittance is 0.1 mmmrad. ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
. Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 32 . Strict Standards : Non-static method JLoader::register() should not be called
... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf -- 237.2 Кб -- 19.03.2008 Похожие документы
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...
Generic Installation and Configuration Guide for gLite 3.1 see here . ... Add new repos into /etc/yum.repos.d/ : cd /etc/yum.repos.d/ wget http://cern.ch/grid-deployment/yaim/repos/glite-UI.repo wget http://cern.ch/grid-deployment/yaim/repos/glite-WN.repo wget http://cern.ch/grid-deployment/yaim/repos/jpackage.repo wget http://cern.ch/grid-deployment/yaim/repos/lcg-CA.repo 2. ... Sample file see as /opt/glite/yaim/examples/siteinfo/site-info.def. ...
... Sov.Phys.-Plasma Phys.) 1978.V.4. ... Timofeev I.B., Bychkov V.L. Influence of ionizing processes on the lifetime of plasma ball in air. ... Bychkov V.L. Database on ball Lightning for PC. ... Bychkov V.L., Bychkov A.V., Stadnik S.A. Polymer Fire Balls in Discharge Plasma. ... Emelin S.E., Bychkov V.L., Astafiev A.M., Kovshik A.P., Pirozerski A.L. Role of discharge products throttling for generation of ball lightning with a condensed core from a high pressure vapor - gas phase Proc. 11-th Intern. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere