... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Understanding Attitudes and Predicting Social Behaviour. ... Bandstatter, H. (1993). Should Economic Psychology care about personality structure? Journal of Economic Psychology, 14(3), 473-494. Berthoud, R., and Kempson, E. (1990). ... Journal of Economic Psychology, 11(4), 545-556. ... British Journal of Social Psychology, 28, 159-171. ... Journal of Economic Psychology, 14(2), 337-376. ... The Economic Mind: The social psychology of economic behaviour. ... The Social Psychology of Aging. ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Radical changes in the life of the country at the end of the twentieth century put the Moscow University within the need of maintaining a high level of classical university education in the new environment. ... In June 2006 the Academic Council of the Moscow State University has decided to establish a new Faculty - Higher School of Management and Innovation (Corporate University) - jointly with JSFC "Sistema" . ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...
... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... 26.10.2015 The Faculty of Journalism, MSU invites you to join the Russian Media and Journalism course which will take place on April 11-24, 2016. ... The course has run five consecutive years and has proved to be effective and inspiring for young people eager to explore the world of Russian media. At the end of the course students receive a certificate (2,5 credits ECTS). ...
Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf -- 583.5 Кб -- 21.09.2015 Похожие документы
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... A new mechanical model of parametrically excited pendulum is proposed. ... Schemes of equivalent parametric pendula We consider the pendulum presented in Fig. 1 which is governed by the same dimensionless equation as the pendulum with vertically vibrating pivot in Fig. 2, see [1, 2] and references therein. ... Stability of inverted position As we see in Fig. 3 (for q < 0 see also Fig. 7) the inverted vertical position, = , see Figs. 5 and 6, can be not only stabilized but also destabilized by...
... Звезды типа Миры Кита и полуправильные Среди пульсирующих переменных звезд поздних классов видное место занимают долгопериодические переменные звезды (ДПП). ... Изменения блеска мирид происходят более или менее регулярно, периоды большинства мирид находятся в интервале от 150 до 600 суток ( рис. ... В 4-м издании Общего каталога переменных звезд (ОКПЗ) ДПП (включая переменные типа Миры Кита, или мириды, и полуправильные переменные поздних классов) составляют самую многочисленную группу переменных. ...
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
... Optimal networks appear as solutions of the fol lowing natural problem: How to connect a finite set of points in a metric space in an optimal way? We cover three most natural types of optimal connection: spanning trees (connection without additional road forks ), shortest trees and local ly shortest trees, and minimal fil lings. ... If this infimum attains at some set N , then each minimal spanning tree for this N is called a shortest tree or a Steiner minimal tree connecting M . ...
[
Текст
]
Ссылки http://dfgm.math.msu.su/files/ivanov-tuzhilin/Lecture_Notes.pdf -- 2275.1 Кб -- 23.10.2012 Похожие документы
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...
Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...
... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...
NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...
Web-service MTPro is designed for defining DNA methyltransferase domain (from RM system)class by specifically made profile search. The class describes a combination of the most common DNA methyltransferase characteristics: methylated atom, motif group, and probable type of RM system. The output format and result definitions see here . Protein sequences of one or more DNA methyltransferases in fasta format is a required information. E-value cutoff . ... Programming: Anna Popenko . ...
... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc -- 37.0 Кб -- 02.04.2012 Похожие документы