... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1997_Scientometrics.doc -- 332.0 Кб -- 16.03.2009 Похожие документы
... Сотрудники . ... Научная работа . ... Сверхпроводимость вызывает огромный интерес, т.к. передача электрического тока без энергетических потерь сулит огромные перспективы. Актуальность поиска соединений для электрохимической интеркаляции мультивалентных катионов, также как и разработки фундаментальных основ кристаллохимического дизайна таких соединений, связана с возрастающими потребностями в легких высокоэффективных возобновляемых химических источниках тока (ХИТ). МГУ им. М.В. Ломоносова . ...
... Data . ... All links ] [ Models ] [ Space weather ] [ Research Institutions ] [ Data sources ] [ News sites ] [ Satellites ] [ Local library ] [ Education ] [ Journals ] [ Events ] . ... NSSDC Space Physics Models . ... Solar Influences Data analysis Center (Royal Observatory of Belgium) . ... Space Weather News Data Base . ... Space Weather Resources (NSSDC) . ... AAS Solar Planetary Division (AAS SPD) . ... Russian Space Science Internet . ... National Space Science Data Center (NSSDC) . ...
... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...
[
Текст
]
Ссылки http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf -- 1512.1 Кб -- 23.03.2016
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/06/Academic-Guide-for-FGS-MSU.pdf -- 1512.1 Кб -- 27.06.2014 Похожие документы
... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...
ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Lab . Main page News People . ASA . Master . Master net Homepage . ... MASTER . ... About Space Monitoring Laboratory, scientific directions, instruments, contacts . People, who work in lab . Latest news and news archive . ... ведущий инженер . ... инженер . ... All news ...
Supernova 2005cs in M51 . This page is devoted to information on Supernova 2005cs in NGC 5194 (= M51 ). ... Information on the original web pages for many of these images can be found on the updates and links web pages. Discovered by amateur Wolfgang Kloehr (Germany) [ Translate ]. ... SNWeb has a 2005cs page . ... Sky and Telescope news release on Supernova 2005cs . ... 2005/01/ . ... mirror . W. Kloehr image . ... Joel Nicolas image . ... Wolfgang Kloehr image . ... 2006/01/06.504 . ...
... Запись в библиотеку . ... Книги . ... История МГУ: библиография . ... В каталоге отражены отечественные газеты с 2013 года по настоящее время, хранящиеся в отделах Научной библиотеки. ... Картотека включает описания материалов (с 2005 г.) по истории МГУ имени М.В. Ломоносова. ... Научная библиотека МГУ имени М.В. Ломоносова (НБ МГУ) - обособленное подразделение в структуре университета, действует на основании Положения о библиотеке . ... 2016 Научная библиотека МГУ имени М.В. Ломоносова (НБ МГУ)ї . ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
Nuclear Instruments and Methods in Physics Research B 161+163 (2000) 748+752 www.elsevier.nl/locate/nimb Characterization of Dyrrhachium silver coins by micro-PIXE method I. Uzonyi a a,* , R. Bugoi b, A. Sasianu c, A.Z. Kiss a, B. Constantinescu b, M. Torb agyi d Department of Electrostatic Accelerators, Institute of Nuclear Research of the Hungarian Academy of Sciences (ATOMKI), P.O. Box 51, Bem ter 18/c, 4001 Debrecen, Hungary b Cyclotron Laboratory, Institute of Atomic Physics ... Nucl. ...
... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... The head of the group was born on October the 3rd, 1941 in the Yaroslavl' region of Russia and twenty-three years later graduated from the Faculty of Physics in the Moscow State University. ... 1989), Professor of astrophysics and stellar astronomy at the Faculty of Physics in MSU (1990). ... 2005, Astronomy Letters, 31 , 160 . ... chernin@sai.msu.ru . ... Staff ...
... research | ... Matvey Viktorovich Youdov . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... B.S./M.S. in Chemistry "Study of structure of humic substances and their hydrolysis products by 1H and 13C nuclear magnetic resonance spectroscopy techniques" Employment: . ... Current research activity is dealing with investigation of structure of hydrolyses products of humic substances by methods of NMR spectroscopy. | ...
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова . Центр Дистанционного Образования Кафедра лингвистики и ИТ . ... которая состоится 10-11 июня 2010 г. на . факультете иностранных языков и регионоведения . ... Педагогические технологии обучения иностранным языкам с применением ИКТ: компьютерно-опосредованное обучение; . ... Дидактические аспекты дистанционного обучения иностранным языкам; . ...
Усовершенствование математической модели процесса удаления БПК из сточных вод. ... Incorporating Research and Industry, 2001. ... С. 640-644. ... Величина БПК достигает (в среднем) 10440 мг на л, ХПК 15 660 мг на л, содержание взвешенных веществ до 5540 мг на л, хлоридов до 3670 мг на л, фосфатов до 320 мг на л. Эти СВ повергались анаэробному сбраживанию, а образовавшаяся при этом биомасса использовалась в качестве удобрения. ...
... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...
... About CIE MSU . Academic Programmes . ... Vestnik CIE (in Russian) . ... Test Your Russian ? ... Russian as a Foreign Language Testing . The Center offers the ТРКИ state examination (Test of Russian as a Foreign Language TORFL) as well as: . ... pilot test exam (in order to determine whether the student is ready to take the certification test); . ... Below you can see the ТРКИ examination network revealing the levels of a command of Russian as a foreign language: . ... Elementary Test. ...