M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...
Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... COMMONWEALTH OF INDEPENDENT STATES (CIS) CHAPTER . ... Dept. of Chemistry, Lomonosov Moscow State university, Leninskie Gory, 119992 Moscow, Russia . ... Dept. of Chemistry, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ... Danchenko Natalya Nikolaevna, Dr. Dept. of Geology, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ... 7(095)2308037 . ... Dept. of Physics, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ...
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...
... Сотрудники . ... Научная работа . ... Сверхпроводимость вызывает огромный интерес, т.к. передача электрического тока без энергетических потерь сулит огромные перспективы. Актуальность поиска соединений для электрохимической интеркаляции мультивалентных катионов, также как и разработки фундаментальных основ кристаллохимического дизайна таких соединений, связана с возрастающими потребностями в легких высокоэффективных возобновляемых химических источниках тока (ХИТ). МГУ им. М.В. Ломоносова . ...
... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...
News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...
[
Текст
]
Ссылки http://unesco.fgp.msu.ru/wp-content/uploads/2016/02/Journal-1.2016.pdf -- 712.2 Кб -- 29.02.2016 Похожие документы
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...
NANO AND GIGA CHALLENGES IN MICROELECTRONICS: RESEARCH OPPORTUNITIES IN RUSSIA . ... Moscow, September 11-13, 2002 . This meeting will bring together scientists and engineers from academia, industry and national labs to discuss recent developments, and explore potential for collaboration solving the most challenging scientific and engineering problems in microelectronics. ... atomic scale design: theory and experiment . highest frequency electronics . ... non-silicon materials and devices . ...
Вы посетили: inv_engl.html . ... История кафедры . ... Visiting Professor at the University of Oslo, Norway, Oslo, November, 2010 . ... Visiting Professor at the University of Ljubljana, Slovenia, August, June 2010 . ... Visiting Professor at the University of Patras and the University of Athens, Greece, June-July 2009 . ... Visiting Professor at the University of Stockholm, Sweden, January ? ... staff/guterman/inv_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...
... About hotel . ... Rooms and prices . ... 1600 rub./day . A cozy room with an area of ??15 sq.m. equipped with modern comfortable furniture, a TV, telephone and bathroom. ... with double bed) . ... A cozy room with an area of ??20 sq.m. equipped with a double bed with bedside tables, wardrobe, desk, TV, telephone and bathroom. ... A large room of 25 square meters with a large bed and bedside tables, coffee table and chair, wardrobe, desk, TV, telephone and bathroom with heated floor. ...
... Help . ... Download SDPfox . SDPfox provides a novel phylogeny-independent method for prediction of specificity-determining positions (SDPs) and grouping sequences into functional sub-groups. You may use the form below to conduct a training set-driven analysis (i.e. predict protein specificity based on a set of known specificities) or download a JAR package that allows for ab initio specificity prediction. ... To get help, run java -jar SDPfox.jar. ...
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...